ID: 1089213823

View in Genome Browser
Species Human (GRCh38)
Location 11:116823536-116823558
Sequence CCTTCCATGCTGAGGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089213823_1089213835 16 Left 1089213823 11:116823536-116823558 CCCACCAACCTCAGCATGGAAGG No data
Right 1089213835 11:116823575-116823597 AACAGTAGGAGAAACACCTCAGG No data
1089213823_1089213836 17 Left 1089213823 11:116823536-116823558 CCCACCAACCTCAGCATGGAAGG No data
Right 1089213836 11:116823576-116823598 ACAGTAGGAGAAACACCTCAGGG No data
1089213823_1089213834 2 Left 1089213823 11:116823536-116823558 CCCACCAACCTCAGCATGGAAGG No data
Right 1089213834 11:116823561-116823583 GGAGGGGAACGGAAAACAGTAGG No data
1089213823_1089213833 -9 Left 1089213823 11:116823536-116823558 CCCACCAACCTCAGCATGGAAGG No data
Right 1089213833 11:116823550-116823572 CATGGAAGGGAGGAGGGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089213823 Original CRISPR CCTTCCATGCTGAGGTTGGT GGG (reversed) Intergenic
No off target data available for this crispr