ID: 1089216672

View in Genome Browser
Species Human (GRCh38)
Location 11:116838159-116838181
Sequence CCTCAGTCTGGGAGCCACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089216672_1089216679 23 Left 1089216672 11:116838159-116838181 CCTCCGTGGCTCCCAGACTGAGG No data
Right 1089216679 11:116838205-116838227 AAACACTCCAGAGATCAATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089216672 Original CRISPR CCTCAGTCTGGGAGCCACGG AGG (reversed) Intergenic
No off target data available for this crispr