ID: 1089216676

View in Genome Browser
Species Human (GRCh38)
Location 11:116838170-116838192
Sequence GGTCTCCGAAACCTCAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089216676_1089216679 12 Left 1089216676 11:116838170-116838192 CCCAGACTGAGGTTTCGGAGACC No data
Right 1089216679 11:116838205-116838227 AAACACTCCAGAGATCAATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089216676 Original CRISPR GGTCTCCGAAACCTCAGTCT GGG (reversed) Intergenic
No off target data available for this crispr