ID: 1089216678

View in Genome Browser
Species Human (GRCh38)
Location 11:116838191-116838213
Sequence GGAGTGTTTTGAAATGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089216678_1089216679 -9 Left 1089216678 11:116838191-116838213 CCTCTTGCATTTCAAAACACTCC No data
Right 1089216679 11:116838205-116838227 AAACACTCCAGAGATCAATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089216678 Original CRISPR GGAGTGTTTTGAAATGCAAG AGG (reversed) Intergenic
No off target data available for this crispr