ID: 1089216679

View in Genome Browser
Species Human (GRCh38)
Location 11:116838205-116838227
Sequence AAACACTCCAGAGATCAATT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089216677_1089216679 11 Left 1089216677 11:116838171-116838193 CCAGACTGAGGTTTCGGAGACCT No data
Right 1089216679 11:116838205-116838227 AAACACTCCAGAGATCAATTCGG No data
1089216672_1089216679 23 Left 1089216672 11:116838159-116838181 CCTCCGTGGCTCCCAGACTGAGG No data
Right 1089216679 11:116838205-116838227 AAACACTCCAGAGATCAATTCGG No data
1089216678_1089216679 -9 Left 1089216678 11:116838191-116838213 CCTCTTGCATTTCAAAACACTCC No data
Right 1089216679 11:116838205-116838227 AAACACTCCAGAGATCAATTCGG No data
1089216676_1089216679 12 Left 1089216676 11:116838170-116838192 CCCAGACTGAGGTTTCGGAGACC No data
Right 1089216679 11:116838205-116838227 AAACACTCCAGAGATCAATTCGG No data
1089216671_1089216679 24 Left 1089216671 11:116838158-116838180 CCCTCCGTGGCTCCCAGACTGAG No data
Right 1089216679 11:116838205-116838227 AAACACTCCAGAGATCAATTCGG No data
1089216674_1089216679 20 Left 1089216674 11:116838162-116838184 CCGTGGCTCCCAGACTGAGGTTT No data
Right 1089216679 11:116838205-116838227 AAACACTCCAGAGATCAATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089216679 Original CRISPR AAACACTCCAGAGATCAATT CGG Intergenic
No off target data available for this crispr