ID: 1089217498

View in Genome Browser
Species Human (GRCh38)
Location 11:116843681-116843703
Sequence ACATCAGGCTGAGCGCGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089217493_1089217498 2 Left 1089217493 11:116843656-116843678 CCCATACATACAGTACCATGTAA 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1089217498 11:116843681-116843703 ACATCAGGCTGAGCGCGTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 90
1089217494_1089217498 1 Left 1089217494 11:116843657-116843679 CCATACATACAGTACCATGTAAA 0: 1
1: 0
2: 1
3: 12
4: 119
Right 1089217498 11:116843681-116843703 ACATCAGGCTGAGCGCGTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089217498 Original CRISPR ACATCAGGCTGAGCGCGTGG TGG Intronic
900610461 1:3542471-3542493 ACATCAGGCTGAGTGGGGGGCGG - Intronic
902472185 1:16656817-16656839 GCATCAGGCTGGGCAGGTGGAGG + Intergenic
902486618 1:16750629-16750651 GCATCAGGCTGGGCAGGTGGAGG - Intronic
905268520 1:36771447-36771469 TCAGCAGGCTGGGGGCGTGGAGG - Intergenic
905704666 1:40045836-40045858 ACATTTGGCCGAGCGCATGGTGG - Intronic
912745162 1:112239854-112239876 AAATCAGGCTGAGGTCCTGGAGG + Intergenic
914847167 1:151289683-151289705 CCATCAGTCTGGGCGCTTGGAGG + Exonic
915153855 1:153858276-153858298 AAATCAGGCTGGGGGCATGGTGG + Intronic
919660770 1:200243213-200243235 ACATCAGGATAAGCACGCGGAGG - Intergenic
920714190 1:208324126-208324148 ACTTCAGGCTGAGGGCCTGCCGG + Intergenic
1065384083 10:25116605-25116627 ACATCACGCAGAGAGCCTGGAGG - Intergenic
1067088059 10:43253194-43253216 ACATCAGGATGAGGTGGTGGGGG - Intronic
1081581701 11:44356591-44356613 GCATCAGGCTGAGGGCAAGGCGG - Intergenic
1083863703 11:65441932-65441954 ACAGCGGGCTGAGGGCATGGTGG - Intergenic
1085242733 11:75071956-75071978 CCATCAGGATGAGCACGTAGAGG + Intergenic
1088969186 11:114756872-114756894 ACATGAGGCTGAGGTCTTGGTGG + Intergenic
1089217498 11:116843681-116843703 ACATCAGGCTGAGCGCGTGGTGG + Intronic
1089606482 11:119644399-119644421 ACATCTGGCTGAGAGGGGGGTGG - Intronic
1089653979 11:119933786-119933808 ACAGCAGGATGAGCCCTTGGAGG + Intergenic
1089667102 11:120027369-120027391 ACATCAGGAAGAGCGTGAGGTGG - Intergenic
1091223977 11:133946774-133946796 ACATCGGGCTGAGCTGGGGGTGG - Intronic
1091665637 12:2416614-2416636 ACTGCAGGCTCAGAGCGTGGTGG - Intronic
1095875941 12:47079965-47079987 GGAGCAGGCTGGGCGCGTGGTGG + Intronic
1096796693 12:54082411-54082433 ACAGCAGGCTGTGTGGGTGGGGG + Intergenic
1099158799 12:79213635-79213657 TCATCAGGCTGGGCGCCTGATGG + Intronic
1110001383 13:70206825-70206847 ACATCTGGCTGTGCTCATGGTGG + Intergenic
1118149980 14:63179050-63179072 ACATCAGGCTGTGCCTGTGCAGG - Intergenic
1125483613 15:40097444-40097466 ACATGAGGCAGAGCGGGTTGGGG + Intronic
1128332400 15:66764050-66764072 AGTTCAGGCTGAGTGAGTGGTGG + Intronic
1133248307 16:4463726-4463748 ACATCGGGCTGAGCACTTGCAGG - Exonic
1133921962 16:10161554-10161576 ACATCAGGCTGTGCCCTTTGTGG - Intronic
1134817585 16:17218788-17218810 ATCTCAGGCTGTGCCCGTGGAGG - Intronic
1136099071 16:27980081-27980103 ACTTCAGCCTGAGCAGGTGGGGG + Intronic
1138431786 16:56973474-56973496 CCATCAGGCTGAGCATGAGGCGG - Exonic
1138594018 16:58019817-58019839 ACATCAGGCCAAGCGCAAGGTGG - Intronic
1141684754 16:85563828-85563850 ACCTCAGGCTGGGCACGTGCAGG + Intergenic
1144766838 17:17737757-17737779 AAATCAGGCTGAGCCCGAGAAGG - Intronic
1146454291 17:32997107-32997129 ACATCAGGCTGGGCCCACGGAGG + Intronic
1148965068 17:51428088-51428110 AAATCAGGCTGATTGAGTGGGGG + Intergenic
1153140191 18:1963320-1963342 AGCTCAGGCTGAGCACATGGTGG + Intergenic
1163620620 19:18357655-18357677 ACACCAGGCTCAGTGGGTGGAGG - Intronic
1168325437 19:55536509-55536531 ACCTCAGGGTGGGCGGGTGGCGG - Intronic
1168706341 19:58472367-58472389 ACATCAGGGGGAGGACGTGGTGG + Exonic
1202704581 1_KI270713v1_random:13611-13633 GCATCAGGCTGGGCAGGTGGAGG + Intergenic
926310270 2:11669901-11669923 GCGCCAGGCTGAGCACGTGGTGG + Exonic
927411279 2:22829185-22829207 ACATCAGGCGGAAAGAGTGGCGG - Intergenic
928063501 2:28139012-28139034 ACAGCAGGCTGTGAGTGTGGTGG - Intronic
928673377 2:33625775-33625797 ACATCAGGCAGAGTGCAAGGTGG + Intergenic
947119625 2:226800601-226800623 ACCTAAGGCTGAGGGCATGGGGG + Intergenic
948084155 2:235232504-235232526 AAATCAGCCAGAGCGGGTGGTGG + Intergenic
1169673784 20:8132458-8132480 TCAGCAGGCAGAGCGCGCGGGGG - Intronic
1170642218 20:18164444-18164466 GCATCAGGCTTAGAGCCTGGGGG - Intronic
1171848160 20:30290424-30290446 ACAGCAGGCTGTGGGGGTGGGGG + Intergenic
1171970680 20:31563123-31563145 ACATCAGGCTGGGCCCTGGGTGG + Intronic
1173194112 20:40899939-40899961 ACAGCAGCCTGAGCCCCTGGAGG + Intergenic
1175876237 20:62231547-62231569 ACAGCAGGCTGAGCCCAGGGTGG - Intergenic
1179354740 21:40648944-40648966 ACAGCAAGCTCAGCGGGTGGGGG + Intronic
1179472419 21:41620545-41620567 ACAGCAGGCTGAGGGCCTTGGGG - Intergenic
1180049328 21:45324162-45324184 ACAGCAGGCTCAGCTCATGGTGG - Intergenic
1181938679 22:26457905-26457927 GCATCAGGCTGACGGCCTGGAGG + Exonic
1184863617 22:47190713-47190735 ACATGTGGCTGGGCCCGTGGCGG + Intergenic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
961491783 3:127261437-127261459 AGAGCAGGCTGAGAGGGTGGTGG - Intergenic
961649187 3:128408935-128408957 GCATCAGGCAGAGCAGGTGGAGG + Intergenic
972354388 4:38266868-38266890 ACATCAGGCTGAGCCATTGCAGG + Intergenic
974386047 4:61202364-61202386 ACAACAGGCAGGGCGCGGGGAGG - Intronic
978954562 4:114598596-114598618 ATGCTAGGCTGAGCGCGTGGCGG + Exonic
986292505 5:6411412-6411434 TCATCAGCCTGAGTGCGTGCTGG - Intergenic
988911998 5:35852549-35852571 ACATGAGGCTGAAGACGTGGGGG + Intergenic
997228917 5:132228719-132228741 ACCTCAGCCTGAGCGGGAGGAGG + Intronic
1008003865 6:46389292-46389314 ACAGCAGGCTGAGTGAGTGCAGG - Intronic
1012773334 6:103470348-103470370 AAATAAGACTGAGCACGTGGTGG + Intergenic
1019701627 7:2477099-2477121 ACCTCAGGCTGAGCATGGGGGGG + Intergenic
1035344255 7:158188198-158188220 CCATCAGGCGGCGAGCGTGGCGG - Intronic
1035344302 7:158188345-158188367 CCATCAGGCGGCGAGCGTGGCGG - Intronic
1035344339 7:158188460-158188482 CCATCAGGCGGCGAGCGTGGCGG - Intronic
1035344357 7:158188518-158188540 CCATCAGGCGGCGAGCGTGGCGG - Intronic
1039963936 8:42270740-42270762 ACCTCAGGCTGAGCGCCTCACGG + Intergenic
1044973795 8:97644391-97644413 ACCTCAGGCCGAGCGCATCGCGG - Exonic
1050064881 9:1749258-1749280 GCATCAGTCTGAGCACGTTGTGG + Intergenic
1053786293 9:41655076-41655098 ACAGCAGGCTGTGGGGGTGGGGG + Intergenic
1054158760 9:61659123-61659145 ACAGCAGGCTGTGGGGGTGGGGG - Intergenic
1054175006 9:61869020-61869042 ACAGCAGGCTGTGGGGGTGGGGG + Intergenic
1054449858 9:65398038-65398060 ACAGCAGGCTGTGGGGGTGGAGG + Intergenic
1054478534 9:65590128-65590150 ACAGCAGGCTGTGGGGGTGGGGG - Intergenic
1054662531 9:67711773-67711795 ACAGCAGGCTGTGGGGGTGGGGG - Intergenic
1061678081 9:132229533-132229555 ACATCAGGCAGGGCACGGGGAGG - Intronic
1062338211 9:136081820-136081842 ACACCAGGCTGAGGGCAAGGCGG + Intronic
1185462127 X:338319-338341 ACATCAGGCCCAGCACGGGGAGG - Intronic
1189993146 X:46613331-46613353 ACACCAGGCGGGGAGCGTGGTGG + Exonic
1199988925 X:152973063-152973085 ACATCAGACTTGGCACGTGGTGG + Exonic
1200535120 Y:4388783-4388805 AAACCAGGCTGAGCCTGTGGTGG - Intergenic