ID: 1089218933

View in Genome Browser
Species Human (GRCh38)
Location 11:116854578-116854600
Sequence GTTGCACAAGACTCTACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089218933_1089218939 28 Left 1089218933 11:116854578-116854600 CCTACAGTAGAGTCTTGTGCAAC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1089218939 11:116854629-116854651 AAACAGCAGGCATTCCTTCCTGG 0: 1
1: 0
2: 1
3: 20
4: 213
1089218933_1089218936 -6 Left 1089218933 11:116854578-116854600 CCTACAGTAGAGTCTTGTGCAAC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1089218936 11:116854595-116854617 TGCAACACAGTTGAGATGGAGGG 0: 1
1: 0
2: 0
3: 21
4: 212
1089218933_1089218937 15 Left 1089218933 11:116854578-116854600 CCTACAGTAGAGTCTTGTGCAAC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1089218937 11:116854616-116854638 GGACCATTAAAAGAAACAGCAGG 0: 1
1: 0
2: 2
3: 26
4: 182
1089218933_1089218934 -10 Left 1089218933 11:116854578-116854600 CCTACAGTAGAGTCTTGTGCAAC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1089218934 11:116854591-116854613 CTTGTGCAACACAGTTGAGATGG 0: 1
1: 0
2: 1
3: 11
4: 154
1089218933_1089218935 -7 Left 1089218933 11:116854578-116854600 CCTACAGTAGAGTCTTGTGCAAC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1089218935 11:116854594-116854616 GTGCAACACAGTTGAGATGGAGG 0: 1
1: 0
2: 3
3: 17
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089218933 Original CRISPR GTTGCACAAGACTCTACTGT AGG (reversed) Intronic