ID: 1089218933

View in Genome Browser
Species Human (GRCh38)
Location 11:116854578-116854600
Sequence GTTGCACAAGACTCTACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089218933_1089218934 -10 Left 1089218933 11:116854578-116854600 CCTACAGTAGAGTCTTGTGCAAC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1089218934 11:116854591-116854613 CTTGTGCAACACAGTTGAGATGG 0: 1
1: 0
2: 1
3: 11
4: 154
1089218933_1089218937 15 Left 1089218933 11:116854578-116854600 CCTACAGTAGAGTCTTGTGCAAC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1089218937 11:116854616-116854638 GGACCATTAAAAGAAACAGCAGG 0: 1
1: 0
2: 2
3: 26
4: 182
1089218933_1089218935 -7 Left 1089218933 11:116854578-116854600 CCTACAGTAGAGTCTTGTGCAAC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1089218935 11:116854594-116854616 GTGCAACACAGTTGAGATGGAGG 0: 1
1: 0
2: 3
3: 17
4: 173
1089218933_1089218936 -6 Left 1089218933 11:116854578-116854600 CCTACAGTAGAGTCTTGTGCAAC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1089218936 11:116854595-116854617 TGCAACACAGTTGAGATGGAGGG 0: 1
1: 0
2: 0
3: 21
4: 212
1089218933_1089218939 28 Left 1089218933 11:116854578-116854600 CCTACAGTAGAGTCTTGTGCAAC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1089218939 11:116854629-116854651 AAACAGCAGGCATTCCTTCCTGG 0: 1
1: 0
2: 1
3: 20
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089218933 Original CRISPR GTTGCACAAGACTCTACTGT AGG (reversed) Intronic
905533198 1:38698557-38698579 GTTGCACAAGAGTCTCTGGTGGG + Intergenic
905753542 1:40487221-40487243 GCTGCTCAAGAATCAACTGTAGG - Intronic
906026430 1:42678054-42678076 GTTGCAAATGTCTGTACTGTAGG - Intergenic
910320341 1:85936632-85936654 GTTGCACAAGCTCCTACAGTGGG + Intronic
910781526 1:90940893-90940915 GTTGAACAAGATTCTGTTGTTGG + Exonic
1064473679 10:15663493-15663515 GATGCACAAGAGTATATTGTAGG - Intronic
1066451787 10:35536689-35536711 GTTCCACAAATCTCTACTGCAGG - Intronic
1067112023 10:43407847-43407869 GTTGCACAAGACTTCCTTGTGGG - Intronic
1081958129 11:47111508-47111530 GTTGCTAACGACTCTCCTGTTGG + Intronic
1085941905 11:81214658-81214680 GTTCCACAAGTCTCTACAGCAGG + Intergenic
1089218933 11:116854578-116854600 GTTGCACAAGACTCTACTGTAGG - Intronic
1089296654 11:117473071-117473093 TTTTCACGATACTCTACTGTGGG - Intronic
1096047124 12:48572110-48572132 TTTACACAAGACTCCACTATTGG - Intergenic
1097587159 12:61528740-61528762 GTAGCACAAGAGTGGACTGTAGG + Intergenic
1102184315 12:110935753-110935775 GTTGAACTAGACTCTCTTGTTGG - Intergenic
1111845349 13:93500853-93500875 GTTGTACAAGGCTTTCCTGTGGG - Intronic
1113163391 13:107409628-107409650 CATGCACAAGGCTCTAGTGTAGG - Intronic
1113269217 13:108654849-108654871 GTTCCACAATTCTCTAGTGTAGG - Intronic
1116154666 14:41187845-41187867 GTTGCACAGGACTCTCCCCTGGG - Intergenic
1121302543 14:92883262-92883284 GTTTCAGAAAAGTCTACTGTCGG + Intergenic
1131876124 15:96807988-96808010 GTTGTACAAGAATATACTGGAGG + Intergenic
1133728905 16:8561232-8561254 GTTGCCCAAGACTGTGCTATAGG - Intergenic
1141772278 16:86096605-86096627 GTTGTACAGGACTCTAATTTGGG - Intergenic
1141960829 16:87406897-87406919 GTCGCACAGGACTCTCCTCTGGG + Exonic
1143702581 17:8672295-8672317 GTTGTTCAAGAGTCAACTGTAGG + Intergenic
1152291942 17:79444751-79444773 TTTGCTCAAGACTAAACTGTAGG - Intronic
1159408131 18:68033162-68033184 GTTGCACAACACTGTTCTGGGGG + Intergenic
1167961010 19:53103804-53103826 GTTCCACAAGACACTACAGATGG - Intergenic
1168131363 19:54321820-54321842 GCTGCCCAGGACTCCACTGTGGG - Intergenic
925523383 2:4772862-4772884 GTTTTACAAAACTCTACTATGGG - Intergenic
927364824 2:22282459-22282481 GTTGCATAAGATTCTACGTTAGG + Intergenic
928071805 2:28224574-28224596 GGTGCTCAAGACACTGCTGTGGG + Intronic
938626994 2:133121307-133121329 GATGCACAAGACTAAACTGAAGG + Intronic
945169806 2:206983621-206983643 CTTGCACATTACTCTTCTGTGGG - Intergenic
948936487 2:241168505-241168527 GTTGCAGAAGACGCGACTGTGGG - Intronic
1175986169 20:62765118-62765140 GTGGCACCAGGCTCCACTGTTGG - Intergenic
1177072393 21:16526973-16526995 CTTGAACATGACTGTACTGTAGG + Intergenic
1177831050 21:26139438-26139460 CTTGCACCAGACTCTACTCAAGG + Intronic
953446139 3:42969355-42969377 GTTTCAGAAGGCTGTACTGTGGG - Intronic
954321469 3:49834642-49834664 GATGCAGAAGGCTTTACTGTTGG - Intronic
969983466 4:11182422-11182444 ATTCCACAACACTCCACTGTTGG - Intergenic
970255182 4:14160697-14160719 GATGCACCAGAATCTACTGGTGG + Intergenic
970798441 4:19943753-19943775 GTTGCCCAAAACTGTAGTGTGGG - Intergenic
974779079 4:66528332-66528354 GTTCCACAAATCTCTAGTGTAGG - Intergenic
976135405 4:81930842-81930864 GTTACACAATGCTCTACTTTTGG - Intronic
982164823 4:152604945-152604967 TTTGCAGAAGACTCTACTAATGG + Intergenic
985880667 5:2636662-2636684 TTTGCACAAGACTCCACAGGGGG - Intergenic
987449718 5:18067304-18067326 CTTGCACAAGACTAAAATGTTGG + Intergenic
989754701 5:44938487-44938509 GTTTCACTAGGCTCTACTGAAGG - Intergenic
1002038446 5:176492030-176492052 TTTGAACCAGACTCTACTCTCGG + Intronic
1003213001 6:4083853-4083875 ATTGAACAAGATTCTGCTGTAGG - Intronic
1003985610 6:11431656-11431678 GCTGCTCAAGATTCTACTCTTGG - Intergenic
1004673566 6:17820278-17820300 GGCTTACAAGACTCTACTGTGGG - Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1008032786 6:46715812-46715834 GTTTGACTAGACACTACTGTTGG - Intronic
1012598449 6:101066745-101066767 GCTGCACAAGAGCCTACCGTTGG + Intergenic
1013565510 6:111356412-111356434 CTTGGACAAGATTCTACTATCGG + Intronic
1013901138 6:115157027-115157049 GTTGCTCAAGAGTCAACTATTGG - Intergenic
1014778105 6:125533695-125533717 GTTTCTAATGACTCTACTGTAGG + Intergenic
1018850052 6:167580781-167580803 ATTGCACAAGACTCTTCACTGGG + Intergenic
1022383955 7:29884648-29884670 GTTGCACAGGACTTTATTGTTGG + Intronic
1029017415 7:97328607-97328629 GTTGCAAGAGGCTCTACTTTGGG + Intergenic
1031083528 7:117280547-117280569 TTTGCACATGACTGTACTGTGGG - Intronic
1032497380 7:132372783-132372805 GTTGCACAAAATTATACTGTTGG - Intronic
1037075250 8:14708215-14708237 GTTGCAAAATAGTCTACTCTGGG - Intronic
1043836653 8:85055114-85055136 CCTTCTCAAGACTCTACTGTAGG + Intergenic
1048107588 8:131428095-131428117 GTTCCACAAGCCTCTAAGGTGGG + Intergenic
1051019358 9:12522861-12522883 TTTGCACAACACTCTAATCTAGG + Intergenic
1051229829 9:14944279-14944301 GTTACACAAGAGTCTAAGGTGGG + Intergenic
1055809268 9:80133286-80133308 GTTGCCCTAGACACTACTGAAGG - Intergenic
1056237336 9:84607938-84607960 GTGGCTCATGACTCTACTGTGGG + Intergenic
1059511134 9:114848504-114848526 GTTGGACCAGATTCTAATGTTGG + Intergenic
1188215032 X:27465327-27465349 CTTGAACTATACTCTACTGTAGG - Intergenic
1188718303 X:33489622-33489644 ATTGCACAAAACTCTAAGGTAGG + Intergenic
1193214917 X:78852544-78852566 GTTGCACAATAATCTTTTGTTGG - Intergenic
1195966118 X:110431788-110431810 ATTGCTGAAGACTCTAGTGTGGG + Intronic
1198374767 X:136027722-136027744 GTTCCACAAGACTATACATTAGG - Intronic