ID: 1089218939 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:116854629-116854651 |
Sequence | AAACAGCAGGCATTCCTTCC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 235 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 20, 4: 213} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1089218933_1089218939 | 28 | Left | 1089218933 | 11:116854578-116854600 | CCTACAGTAGAGTCTTGTGCAAC | 0: 1 1: 0 2: 0 3: 5 4: 71 |
||
Right | 1089218939 | 11:116854629-116854651 | AAACAGCAGGCATTCCTTCCTGG | 0: 1 1: 0 2: 1 3: 20 4: 213 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1089218939 | Original CRISPR | AAACAGCAGGCATTCCTTCC TGG | Intronic | ||