ID: 1089218939

View in Genome Browser
Species Human (GRCh38)
Location 11:116854629-116854651
Sequence AAACAGCAGGCATTCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089218933_1089218939 28 Left 1089218933 11:116854578-116854600 CCTACAGTAGAGTCTTGTGCAAC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1089218939 11:116854629-116854651 AAACAGCAGGCATTCCTTCCTGG 0: 1
1: 0
2: 1
3: 20
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089218939 Original CRISPR AAACAGCAGGCATTCCTTCC TGG Intronic