ID: 1089220999

View in Genome Browser
Species Human (GRCh38)
Location 11:116871570-116871592
Sequence GTGTGAAAAGGGCTGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 341}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089220994_1089220999 -4 Left 1089220994 11:116871551-116871573 CCAGCTTACTCTAGCTGCAGTGT 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1089220999 11:116871570-116871592 GTGTGAAAAGGGCTGGTGGCAGG 0: 1
1: 0
2: 0
3: 32
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089220999 Original CRISPR GTGTGAAAAGGGCTGGTGGC AGG Intronic
900524099 1:3120080-3120102 GTGGGATAAGGGCTGGTGGTGGG - Intronic
901283351 1:8057012-8057034 ATGTGACAAGGCCAGGTGGCTGG - Intergenic
901286183 1:8080637-8080659 GTGAGAAAAGTGATCGTGGCAGG + Intergenic
901380547 1:8870827-8870849 GAGTGCACAGGGCTGGTGCCAGG + Intronic
902117096 1:14130242-14130264 GTGTGGGGAGGGCAGGTGGCTGG + Intergenic
902245815 1:15119817-15119839 GTGTGCAAAGGTCCTGTGGCAGG + Intergenic
902676126 1:18009591-18009613 GTGAGAAAGCGGCTGGTGCCAGG - Intergenic
903695994 1:25207362-25207384 GTTTGAAATGTGCTTGTGGCTGG + Intergenic
903757764 1:25674651-25674673 GTGTGCAAAGGCCCTGTGGCAGG + Intronic
903967203 1:27098392-27098414 CTGAGAAAAGGCCGGGTGGCTGG - Intergenic
904013876 1:27405914-27405936 TCGTGGAAAGGGCTGGGGGCAGG - Exonic
904620614 1:31772919-31772941 GTGTGCCCAGGGCTGGCGGCGGG - Intergenic
904701126 1:32358820-32358842 GTGGGTAAAGGCCTGGAGGCAGG - Intronic
904874119 1:33640860-33640882 GTGGGAATAGGGGTGGTAGCAGG + Intronic
906265694 1:44427437-44427459 GGGTGAAAAGGGCTTGTGAGTGG - Intronic
907184486 1:52599506-52599528 GAGTGAAAGGGACAGGTGGCAGG + Intergenic
907425266 1:54375514-54375536 GTGTGAAAGTGGCTGGCAGCAGG - Intronic
907617881 1:55943145-55943167 GTGTGGAGGGGGGTGGTGGCTGG + Intergenic
908686507 1:66725925-66725947 GTGTGAACATGGCAGGAGGCTGG + Intronic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
912509845 1:110181793-110181815 GTGTGAAAAGGACTTGAGACTGG + Intronic
913171957 1:116241197-116241219 ATGTGAAAATGCCTGGGGGCAGG + Intergenic
915323812 1:155070414-155070436 GTGTGCAAAGGGGTGGGGGAGGG - Intergenic
915511382 1:156388682-156388704 GCCTGAAAAGGGCTGGCGGCCGG + Intergenic
915518601 1:156428521-156428543 GTGTGAAGAGGGCTGGGGTAGGG + Intronic
916491868 1:165309214-165309236 GTGTGCCAAGGGCTGGGGGTGGG - Intronic
917716698 1:177745589-177745611 GTGAGGAAAGGGAGGGTGGCTGG - Intergenic
920915665 1:210256145-210256167 CTGTGACAAGGGCTCCTGGCAGG + Intergenic
921179621 1:212621730-212621752 GTTTCATAATGGCTGGTGGCTGG - Intergenic
921832591 1:219744714-219744736 TTGTGAAAATGGCAAGTGGCTGG - Intronic
922007591 1:221547807-221547829 GTATAAAAAGGGCTGGGGACTGG + Intergenic
922238126 1:223736642-223736664 GTGTGAAAAGGACTGAAAGCAGG - Intronic
923701887 1:236307538-236307560 TGGTGAAAAGGGCTGATGTCAGG - Intergenic
924402326 1:243699131-243699153 GTCTTAAAAGGATTGGTGGCAGG - Intronic
924476170 1:244383696-244383718 ATGTGCAAAGGCCTTGTGGCAGG + Intronic
1063216772 10:3932385-3932407 CTGTGGCAAGGGCTGGGGGCAGG + Intergenic
1063427175 10:5959634-5959656 GTGTGGAAGGGGCTGCTGTCAGG + Intronic
1063560588 10:7122763-7122785 GTGTGCAAAGGTCCTGTGGCAGG + Intergenic
1063732401 10:8712876-8712898 GTGTGACAAGGGCTGGTTGATGG + Intergenic
1064178004 10:13091992-13092014 CAGTGAAAAGGGCTGATGGTGGG + Intronic
1064273330 10:13884745-13884767 TTGTGAAGATGGCAGGTGGCAGG - Intronic
1065623622 10:27608783-27608805 TTGGGAAAAGGTTTGGTGGCTGG + Intergenic
1067550520 10:47231599-47231621 GTGTGTGTAGGGGTGGTGGCTGG - Intergenic
1069085249 10:64131312-64131334 GTGAGAAAAGGTCAGATGGCAGG - Intergenic
1069323053 10:67197543-67197565 GTGTGAAAATGACTGCTGGGTGG + Intronic
1070774998 10:79104259-79104281 GTGAGTAAAGGCCTGGAGGCTGG + Intronic
1070782136 10:79143776-79143798 GTGTGATAGGGGCTGGGGGGTGG + Intronic
1071368685 10:84928060-84928082 GTATGTAAAATGCTGGTGGCAGG + Intergenic
1072726396 10:97816668-97816690 GTGAGAAATGGGATGGTGGCTGG + Intergenic
1072751793 10:97986066-97986088 GTGGGAAAAGGGCTGGGCTCTGG + Intronic
1074106379 10:110392570-110392592 GAGTGAGTAGGGCTGGTGCCTGG + Intergenic
1075485973 10:122822331-122822353 GTGTTGAATAGGCTGGTGGCTGG + Intergenic
1075547253 10:123364267-123364289 GTGTGACAAGGGCTGGTGTAGGG + Intergenic
1075605381 10:123801530-123801552 GAGTGAACTGGGGTGGTGGCAGG - Intronic
1075809726 10:125216239-125216261 GAGGGAACTGGGCTGGTGGCTGG + Intergenic
1076783476 10:132737232-132737254 GTGTCCAGAGGGCAGGTGGCAGG + Intronic
1076889753 10:133277656-133277678 GTGGGAACAGTGGTGGTGGCAGG + Intergenic
1076946534 10:133655582-133655604 ATGTGAAAAGGGCCAGTGCCTGG + Intergenic
1077133699 11:987921-987943 GTGTGCAAGGGGCTCGTGGTGGG + Intronic
1080245250 11:30172862-30172884 CTCAGAAATGGGCTGGTGGCTGG - Intergenic
1081661833 11:44893154-44893176 CAGAGGAAAGGGCTGGTGGCAGG + Intronic
1081776330 11:45678276-45678298 GTGTCAAAACGGCAGGTGGAGGG - Intergenic
1083203174 11:61132200-61132222 CTGGGAAAGGGGCCGGTGGCAGG + Exonic
1083601953 11:63954302-63954324 AGGAGAAAAGGGTTGGTGGCAGG - Intronic
1084349384 11:68584299-68584321 CTGGGAAAAGGGCTGCTTGCAGG - Intronic
1084525967 11:69698173-69698195 GTGGGGAAGGGGCTGGTGGGGGG - Intergenic
1084536086 11:69758001-69758023 GTGTGCAAAGGCCCGGGGGCAGG + Intergenic
1084708774 11:70831089-70831111 GTGTGAGTTGGGCTGGGGGCAGG + Intronic
1084733154 11:71087408-71087430 CTGGCAAAAGGGCTGGCGGCTGG + Intronic
1084752789 11:71215058-71215080 GTGGGAGAATGGCTGGTGGAGGG - Intronic
1084930674 11:72553300-72553322 TTGTGCAAAGGTCTGGAGGCAGG - Intergenic
1085218946 11:74856685-74856707 GTGTGAGAAAGACTGGAGGCAGG + Intronic
1085449656 11:76624178-76624200 GTGTGATAAGGGCTGGGGTCAGG - Intergenic
1087265959 11:96061386-96061408 GTTTGAAATGAGCTGGAGGCAGG + Intronic
1087269722 11:96098955-96098977 TTGTGGAAAGGGATGGGGGCAGG - Intronic
1089023492 11:115242750-115242772 ATGTGGAAAGGCCTGGTGACGGG + Intronic
1089220999 11:116871570-116871592 GTGTGAAAAGGGCTGGTGGCAGG + Intronic
1089365004 11:117916084-117916106 GTGTGGAAACGTCTGCTGGCAGG - Intronic
1089460075 11:118647864-118647886 GTGTGAAGAGGGCCAGTGGGGGG + Intronic
1089468315 11:118700599-118700621 GGGTCAGAATGGCTGGTGGCTGG - Intergenic
1089760802 11:120721664-120721686 GGGTGATTAGGGCAGGTGGCTGG + Intronic
1090410234 11:126503181-126503203 GTGTGAAAAGGGAGTGTTGCTGG + Intronic
1090727911 11:129544177-129544199 ATGTGAGAAGGGCTGGGGGCAGG - Intergenic
1092287403 12:7136758-7136780 TGGTGAAAAGGGCAGGAGGCAGG - Intronic
1094102559 12:26779524-26779546 GAGAGAGAAGGCCTGGTGGCAGG - Intronic
1095089311 12:38088899-38088921 ATGTGACAAGGGCTGGTGCCCGG - Intergenic
1096842052 12:54385650-54385672 GTATGAAAGGGGGTGGTGTCTGG - Intronic
1097279028 12:57833185-57833207 GGGTGAAAGGGGCAGCTGGCTGG + Intronic
1097958045 12:65506337-65506359 GGGTGGAAAAGGCTGGTGTCGGG + Intergenic
1101718255 12:107330103-107330125 ATGTGCAAAGGGCCTGTGGCAGG + Intronic
1101876401 12:108599171-108599193 GTGGGTAAAGGTATGGTGGCTGG + Intergenic
1102122608 12:110454250-110454272 GAGGGAAAAGGGCTGTGGGCTGG - Intronic
1102233740 12:111281294-111281316 TTGTGCAAAAGGCTGGTGGCTGG - Intronic
1102548109 12:113671200-113671222 GTGTGAAAAGGGAAAGTGACTGG - Intergenic
1102915486 12:116749282-116749304 GTCTCAAAAGGGGTGGTGGGGGG - Intronic
1103413062 12:120726150-120726172 CTGGGAACTGGGCTGGTGGCTGG - Intronic
1104876665 12:132039579-132039601 GTGAGAAACGGGGTGGTGGCGGG - Intronic
1105008809 12:132740714-132740736 ATGTGAAAACGGCTGGTTTCAGG - Intronic
1105013996 12:132774834-132774856 GTGTGTGAAGGGCTGGGGCCCGG - Intronic
1106168527 13:27270017-27270039 ATGGGAAAAGGGCGGGGGGCGGG - Intergenic
1107135303 13:36938098-36938120 TTGGGAGAAGGGCTGGTGCCTGG + Intergenic
1108365871 13:49712037-49712059 GTGGGAAATGGGCTGGTAGGTGG - Intronic
1108506364 13:51116147-51116169 GTACACAAAGGGCTGGTGGCGGG + Intergenic
1109471200 13:62806649-62806671 GTGGGAAAAGGGATGGTTGTTGG + Intergenic
1112508088 13:99987515-99987537 GTGGGAGAAAAGCTGGTGGCTGG - Intergenic
1115975356 14:38990934-38990956 GGGATAAAAGGGCAGGTGGCCGG + Intergenic
1117252708 14:53952584-53952606 GGGTGAAAAGGGGTGGGGGAGGG + Intronic
1117834445 14:59787692-59787714 GTGGGGAAGAGGCTGGTGGCAGG + Intronic
1119649232 14:76371952-76371974 GTGCAAAAATGGCTGGTGTCTGG + Intronic
1119724466 14:76913789-76913811 GTGGGATGAGGGGTGGTGGCAGG + Intergenic
1119921457 14:78450399-78450421 GTGTTAAATGGGATGGAGGCTGG + Intronic
1120952175 14:90051406-90051428 GTGAAAAATGGGCTGGTGACTGG + Intergenic
1123028119 14:105438193-105438215 CTGTGGGCAGGGCTGGTGGCTGG + Intronic
1123067977 14:105627799-105627821 AGGTGAAAAGGGCCGGTGGGGGG - Intergenic
1202924290 14_KI270724v1_random:9444-9466 ATGTGAAAAGGGCCAGTGCCTGG - Intergenic
1123403955 15:20009674-20009696 GGGTAGAAAGGGCTGGAGGCAGG + Intergenic
1123513295 15:21016320-21016342 GGGTAGAAAGGGCTGGAGGCAGG + Intergenic
1123796827 15:23781039-23781061 AGGTGAAGAGGGCTGGTGGAGGG + Intergenic
1125573294 15:40737605-40737627 GTATGAGAGGGGCAGGTGGCAGG - Intronic
1126578448 15:50220480-50220502 GTAGGAGAAGGGCTGCTGGCGGG + Intronic
1128543535 15:68552781-68552803 TTGAGGAAAGGTCTGGTGGCAGG - Intergenic
1128933891 15:71729129-71729151 GTCTGAACAGGGCTGGGAGCTGG - Intronic
1129705912 15:77794127-77794149 GGGTGACAAGGGCAGGGGGCAGG - Intronic
1130332427 15:82932831-82932853 GTGTGCACAGGGCAGGAGGCAGG - Intronic
1130561480 15:84962775-84962797 GTGTGACTAGGGCTGGGGGTAGG + Intergenic
1131605554 15:93899931-93899953 GTGGGATCTGGGCTGGTGGCGGG - Intergenic
1132237833 15:100235262-100235284 ATGTCAGTAGGGCTGGTGGCAGG + Intronic
1133056190 16:3146496-3146518 GTTAGAAAAGGGCTTCTGGCCGG + Intronic
1135627993 16:24012873-24012895 ATGTGCAAATGCCTGGTGGCAGG - Intronic
1137506232 16:49056308-49056330 GTATGAAAAGTGCTGGTCCCTGG + Intergenic
1137603088 16:49769749-49769771 GTGTGAAATGAGGTGGTGGGGGG - Intronic
1137758361 16:50920283-50920305 GTGTGAAGAGGGCAGCTGGCAGG + Intergenic
1138979572 16:62250627-62250649 TTTTGAAAAGAGCTGATGGCAGG + Intergenic
1139588299 16:67918471-67918493 GGGTGACAAGGGCTGGTGGGAGG + Intronic
1141064852 16:80906029-80906051 GTAAGAAAAGGTCTTGTGGCAGG + Intergenic
1141514950 16:84537656-84537678 CTGTGAAAAAGGCTGGTGTGGGG + Intronic
1141613938 16:85199621-85199643 CTGTGAAAAGTGCTGCGGGCCGG + Intergenic
1142380714 16:89730421-89730443 GTGTGAGGAGGGCTGGGAGCTGG + Intronic
1142759268 17:2033910-2033932 GTGGGTAAAGCCCTGGTGGCGGG + Intronic
1143235291 17:5394309-5394331 TTGAGAAAAGGGCTGCTGGCGGG + Intronic
1145867030 17:28248022-28248044 GTTTGAAAAGGTGTGGTGGGGGG + Intergenic
1147790949 17:43014053-43014075 ATGGGAGAAGGGCTGGGGGCTGG - Intronic
1148468117 17:47877156-47877178 CTTTGAAAAGCCCTGGTGGCAGG + Intergenic
1148657483 17:49298587-49298609 GTGTGAGAAGGGGTGGGGGATGG + Exonic
1150384911 17:64751076-64751098 ACGTGAAGAGGGCTGGTGGGTGG + Intergenic
1151396578 17:73826960-73826982 GAGTGAACAGGTCTGGGGGCTGG - Intergenic
1151527481 17:74680939-74680961 ATGTGAACAGGGGTGGTGGTGGG - Intronic
1151957502 17:77387777-77387799 GTGTGAACGGGGCTGGGAGCAGG + Intronic
1152928375 17:83098228-83098250 GAGGGAAAAGGGCAGGTGGAGGG - Intergenic
1153732006 18:8023211-8023233 GAAGGAAAAGGGCTGATGGCTGG + Intronic
1153788213 18:8553820-8553842 GGGTGCCAGGGGCTGGTGGCGGG + Intergenic
1154018872 18:10645079-10645101 GTCTGCAGAGGGCTGGTGCCCGG - Intergenic
1154185358 18:12178344-12178366 GTCTGCAGAGGGCTGGTGACCGG + Intergenic
1155180188 18:23338636-23338658 ATGTGAAAATGGCTGGGGGGTGG - Intronic
1156455181 18:37289167-37289189 GGGTGAGAAGGGATGGGGGCTGG + Intronic
1156682257 18:39605312-39605334 GTGGGAAAAGGAGTGGGGGCTGG - Intergenic
1157381329 18:47221017-47221039 GAGAGAAAGGGACTGGTGGCAGG - Intronic
1159190806 18:65039713-65039735 GGGTGAAAAGGGATGGAGGAGGG - Intergenic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1160178294 18:76613439-76613461 CTGAGAAAAGGGATGGAGGCAGG + Intergenic
1160796344 19:947462-947484 CTGTGAAACGGGCTGGCGGCCGG + Intronic
1160875575 19:1294983-1295005 GTGTGCAAAGGGCCGGCGGGGGG - Intronic
1161195263 19:2983037-2983059 GGGAGAAAAGGCCAGGTGGCGGG - Intronic
1161813390 19:6483922-6483944 GTGTGAAAACACCTCGTGGCCGG + Intergenic
1162337315 19:10069989-10070011 ATGTGCAAAAGTCTGGTGGCAGG + Intergenic
1162352145 19:10157343-10157365 GTGTGAAAAGGGATGTGGGAAGG + Intronic
1162366954 19:10255526-10255548 GTGTGCAAAGGCCCTGTGGCAGG + Intronic
1162573966 19:11487882-11487904 GTGGGCAATGGGCTGGTGGCTGG - Exonic
1164539104 19:29109078-29109100 GTGAGAAAAGGCTGGGTGGCTGG + Intergenic
1165423767 19:35734563-35734585 GTGGGAAGAGGCCTGGTGGCTGG + Intronic
1166588525 19:43973349-43973371 GTGGGGAAAGGGCGGGGGGCTGG - Intronic
1166852677 19:45767974-45767996 GGGGGAAGAGGGCTGGTGGACGG + Intronic
1166995447 19:46717596-46717618 GTGTTAAATGGGCTGGGGCCGGG - Intergenic
1167115603 19:47487571-47487593 GTGTGAGAGGGACTGGTGACTGG + Intergenic
1167354936 19:48997869-48997891 ATGTGAGAAGGGGTGGTAGCTGG + Intronic
1168340387 19:55619828-55619850 GAATGAAGAGGGCAGGTGGCCGG + Intergenic
927784081 2:25960333-25960355 GTCTGAAAAGGACTGGTGTAAGG + Intronic
928259777 2:29756134-29756156 ATGTGCAAAGGCCTGGAGGCGGG - Intronic
928914855 2:36459743-36459765 GAGTGATAAGGGGTGGTGGCAGG + Intronic
929670321 2:43872129-43872151 GTGTGGAAAGGTAAGGTGGCAGG + Exonic
931463498 2:62467806-62467828 GTCTGCAAAGGCCAGGTGGCAGG + Intergenic
931906217 2:66846516-66846538 GTTTGAAAGGGGCTGGGAGCAGG - Intergenic
932216607 2:69970183-69970205 GTGTGAAGAGGCATGGAGGCAGG - Intergenic
932701845 2:73997528-73997550 GTGGGAGAAGAGCTGGTGCCAGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933690064 2:85172852-85172874 GGGTGAAGAGGGCTGGAGGTGGG - Intronic
934679802 2:96275325-96275347 ACGTGAAGAGGGCTGGTGGGTGG - Exonic
937361972 2:121235909-121235931 GTGGGAGTAGGGGTGGTGGCTGG - Intronic
937664447 2:124468732-124468754 ATGTGTTAAGGGCTGGTAGCTGG - Intronic
938247997 2:129793839-129793861 GTGTAAAGAAGGCTGGGGGCTGG - Intergenic
938316069 2:130328972-130328994 CTGAGAGAAGGGCTGGTGGCTGG - Intergenic
938580262 2:132639263-132639285 GGGGGATAAGGGCTGGGGGCTGG + Intronic
939609598 2:144294275-144294297 ATGTGCAAAGGCCTTGTGGCAGG - Intronic
941576063 2:167231785-167231807 TTTTGATAATGGCTGGTGGCAGG + Intronic
943675821 2:190715659-190715681 GAGTGAACAAAGCTGGTGGCTGG + Intergenic
944199849 2:197094991-197095013 ATGTGCAAAGGCCTGGGGGCAGG - Intronic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
946194789 2:218026658-218026680 GTGGGAAAAGGGCTGGAGGGAGG - Intergenic
947440874 2:230120514-230120536 GGGAGAAAAGGCATGGTGGCAGG - Intergenic
948589400 2:239039520-239039542 CTGTGCAAAGGCCTGGAGGCAGG + Intergenic
948653220 2:239462051-239462073 GAGTGAAGAGGGAGGGTGGCCGG - Intergenic
1171089615 20:22271572-22271594 GTGGGAAGAGGGCTCATGGCAGG + Intergenic
1171461500 20:25300627-25300649 GTGTGGAAAGCGTGGGTGGCAGG - Intronic
1172129841 20:32648237-32648259 GAGTGCAAAGGCCTGGAGGCAGG - Intergenic
1172655449 20:36534096-36534118 ATGTTAAAAGTACTGGTGGCTGG + Intergenic
1172859032 20:38033170-38033192 GCGTGAAAAGGGCACGTGGGTGG + Intronic
1172937188 20:38628828-38628850 CTGTGAAAAGGGGTTGTGGGTGG + Intronic
1173111803 20:40197939-40197961 GTGTGAAATGGGTTGGTTGCTGG + Intergenic
1173192520 20:40887261-40887283 GTGTGAAAGGGGCTGGGGCCTGG - Intergenic
1174227486 20:49013876-49013898 CTTTGAAAAGCACTGGTGGCAGG + Exonic
1174424523 20:50422709-50422731 TTGTGCAAAGGGCTGGAGGCAGG + Intergenic
1175163890 20:57029519-57029541 GTGTGCAAAGACCTTGTGGCTGG + Intergenic
1175415250 20:58796725-58796747 GTGTGGAAGGGGCAGGTGTCTGG - Intergenic
1175925517 20:62469440-62469462 GTGTGCTAAGGGGTGATGGCCGG - Intronic
1175942303 20:62543139-62543161 GTGTTGAAAGGGCTGGCTGCTGG + Intergenic
1175945051 20:62554804-62554826 TTTGGAAAAGGGCAGGTGGCTGG + Intronic
1176331148 21:5549381-5549403 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1176396609 21:6271570-6271592 ATGTGAAAAGAGCTGGTTCCCGG + Intergenic
1176440548 21:6717534-6717556 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1176464810 21:7044603-7044625 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1176488371 21:7426382-7426404 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1178528897 21:33357904-33357926 GTCTGAAAAGCAATGGTGGCAGG - Exonic
1179571412 21:42280902-42280924 GTCTGGAAAAGGCTGGTGGGTGG - Intronic
1179841993 21:44082632-44082654 GTGTGAAGATGGCAGGAGGCTGG + Intronic
1179941334 21:44640370-44640392 GTGTGACCAAGGCTGGTGGAGGG + Intronic
1181442918 22:22946886-22946908 GTGTAAACAGGGCTGGGGGCGGG - Intergenic
1181629173 22:24141575-24141597 GTGGGGCAAGGGCTGGTGGGAGG - Intronic
1181998990 22:26904659-26904681 ATGTGCAAAGGCCTGGTGGCCGG + Intergenic
1183299323 22:37051312-37051334 GTGTGTATAGGGGTGGGGGCGGG - Intergenic
1183883815 22:40859234-40859256 TTGGGAAAAAAGCTGGTGGCTGG + Intronic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1184208113 22:43018065-43018087 GGCTGAAAAGGGGTGGAGGCAGG - Intergenic
1184259159 22:43304845-43304867 GTGTGCAAAGGGATGGTGTGGGG - Intronic
1184417339 22:44359909-44359931 GTGTGCAAAGGGCCAGGGGCAGG + Intergenic
1185269508 22:49922667-49922689 GTGTGAAGTGGGCTGGGTGCTGG + Exonic
1185314752 22:50174214-50174236 GGGTGGAAAGGGCTGTTGGGAGG + Intronic
949980447 3:9499315-9499337 GTGTGGATGGGGCAGGTGGCAGG - Exonic
950121496 3:10485024-10485046 CTGTGAAAGGGGCTGGTTGAGGG + Intronic
950263727 3:11560148-11560170 GAGTGAAAAGCGGTGGTGGTGGG - Intronic
950533053 3:13564158-13564180 GTGTGAACAGGCTGGGTGGCTGG + Intronic
950542095 3:13618813-13618835 GTGTGAGAAGGGCAGGTGCCTGG + Intronic
953492879 3:43365007-43365029 GTGTCAAAAGGGATATTGGCAGG - Intronic
953543152 3:43840556-43840578 GTGTGCAAAGGTGTGGAGGCAGG + Intergenic
954300651 3:49699182-49699204 GGGTGCCATGGGCTGGTGGCAGG + Intronic
954443065 3:50532206-50532228 GAGTGCAAAGGCCTGGAGGCAGG + Intergenic
957080939 3:75634895-75634917 ATGTGAAAAGGGCCAGTGCCTGG - Intergenic
959431081 3:106256193-106256215 GGGTGAAAAGGGCCGGGGGGCGG - Intergenic
960231628 3:115234850-115234872 GTGTGAGAAGAGATGGTGGTAGG + Intergenic
960737562 3:120797368-120797390 TTGTGAAAAGGGCAGGTCCCAGG - Intergenic
961386290 3:126525053-126525075 GTGTGAAATGGGTTGATGGGAGG - Intronic
961554791 3:127690449-127690471 GTGTGATCAGGGCTGCTGGAGGG + Exonic
961804167 3:129476846-129476868 AGGTGGAAAGGGCTGGTGACAGG + Intronic
962272120 3:133984974-133984996 GTGTGGGACGGGCAGGTGGCAGG - Intronic
962755551 3:138463096-138463118 GTGTGAAGGGAGGTGGTGGCGGG + Intronic
963004670 3:140715333-140715355 ATGTGGAAAAGGCTGGTGGACGG - Intergenic
963542665 3:146613616-146613638 GGGGGAAAAGAACTGGTGGCAGG - Intergenic
966871210 3:184291522-184291544 GTGTCAAACGGGCTGGTGAATGG + Intronic
967276813 3:187784285-187784307 GTTTGAAAAGGTCTTGTGGCTGG + Intergenic
967635153 3:191792076-191792098 GTGTGAAAGGACCTGGTGGGAGG - Intergenic
968375045 4:32753-32775 ATGCGAGATGGGCTGGTGGCAGG + Intergenic
969951537 4:10841461-10841483 GAGTGAATGGGGCTGGAGGCAGG + Intergenic
971254983 4:25006231-25006253 GGGTGATAAGGGATGGTGGGAGG - Intronic
972762666 4:42122159-42122181 GTGTGCAAAGTGCTTGGGGCAGG - Intronic
976096718 4:81516217-81516239 GTATCAAAAGGGCTGGGGACAGG - Intronic
978787502 4:112626082-112626104 GTTTGCATAGGGCTGGGGGCTGG + Intronic
981513504 4:145582911-145582933 GTGTGAGAAGTGATGGTAGCAGG - Intergenic
981644278 4:146980805-146980827 TTGAGAATATGGCTGGTGGCGGG + Intergenic
982099455 4:151953799-151953821 CTGAGACAAGTGCTGGTGGCTGG - Intergenic
982303459 4:153903802-153903824 ATGGGAAAAGGGAAGGTGGCTGG + Intergenic
983272289 4:165576389-165576411 GTGGGTAAAGGGCTGGTAGGTGG - Intergenic
983406589 4:167338884-167338906 TTATGAAAAAGGTTGGTGGCAGG + Intergenic
985449952 4:190056241-190056263 ATGTGAAAAGGGCCAGTGCCTGG + Intergenic
985459998 4:190096291-190096313 ATGCGAGATGGGCTGGTGGCAGG - Intergenic
985468968 5:25319-25341 ATGTGAGATGAGCTGGTGGCAGG + Intergenic
988556689 5:32242674-32242696 GTGTGGGAAGGGAAGGTGGCTGG - Intronic
989204024 5:38793810-38793832 GTGTGAAGAGGTCTGGGGACAGG - Intergenic
991377712 5:65983990-65984012 GTGGGAGAAGGGCAGCTGGCTGG - Intronic
992074162 5:73175701-73175723 GGGTGAAAATGGCAGGGGGCTGG - Intergenic
995813738 5:116141689-116141711 CTGGGAAGAGGGGTGGTGGCTGG + Intronic
996389751 5:122947045-122947067 GAGTGAACATGGCTGGGGGCAGG + Intronic
997299174 5:132789850-132789872 ATGTGAAGGGGGCTGGAGGCAGG - Intronic
999077149 5:148807134-148807156 ATCTTAAAAGAGCTGGTGGCTGG + Intergenic
999448067 5:151657254-151657276 GAGTGCAAAGGCCTGGAGGCAGG + Intergenic
999890219 5:155970204-155970226 GGGTGAAATGGGATGGGGGCTGG - Intronic
1001442082 5:171750813-171750835 GTGAGCAAAGGCCTGGAGGCAGG - Intergenic
1001912932 5:175535914-175535936 GTGAGAGAAGGGCTGGGCGCTGG + Intergenic
1002061125 5:176626684-176626706 GTGAGAGAAGGGCTGGTGCCAGG + Intronic
1002415816 5:179120557-179120579 GTGTGAACAGAGGCGGTGGCTGG + Intronic
1002858510 6:1058929-1058951 GTGTCAAAAGGGAAGGAGGCCGG + Intergenic
1003539172 6:7003067-7003089 TTTTTAAAAGGCCTGGTGGCTGG + Intergenic
1006357523 6:33568728-33568750 GTGTGAGAGGGGCTGTGGGCAGG - Intergenic
1006409421 6:33863661-33863683 GTGTGGTTAGGGCTGGAGGCAGG - Intergenic
1006470778 6:34227455-34227477 GAGTGAAAAGGGCTGGGGGAGGG - Intergenic
1006526554 6:34610885-34610907 GGGAGAAAAGGGGTGGTGGTAGG - Intronic
1006811107 6:36821208-36821230 AGGTGAAAAGGCCTGGAGGCGGG + Intronic
1008040271 6:46790029-46790051 GTGTGGAAATAGCTGGGGGCGGG + Intergenic
1008795647 6:55299496-55299518 GTGTTAAAGCGGATGGTGGCTGG - Intergenic
1011412408 6:87079551-87079573 GTGTATAAAGGGTTGCTGGCAGG - Intergenic
1012398061 6:98822520-98822542 GTGAGGAAAGGGCTGGAGGGTGG + Intergenic
1013206215 6:107948196-107948218 GTGTTAAAATGGCTAGTGGAAGG - Intronic
1015589124 6:134805463-134805485 GCGTGTAAAGGGCTGGAGGAGGG - Intergenic
1015946352 6:138505123-138505145 GTGTAAATAGGGATGGGGGCGGG - Intronic
1016076233 6:139799371-139799393 GTGTCAAGTGGGCTGGTGGAAGG + Intergenic
1016553905 6:145313853-145313875 GTGTGAAAAGGACAGGTTGCAGG - Intergenic
1017992230 6:159501065-159501087 GTGTGAAGTGGGGTGGTGGGTGG - Intergenic
1018002218 6:159589387-159589409 GTGTGTAAAGAGCAGGAGGCTGG - Intergenic
1019487786 7:1297197-1297219 GTGTGGGAGGGGGTGGTGGCAGG + Intergenic
1019648636 7:2144397-2144419 CTTTGGAGAGGGCTGGTGGCGGG - Intronic
1023967778 7:44971956-44971978 GAGTGAAAATGGCTGATGGAGGG - Intronic
1024056770 7:45664426-45664448 GGGGGATAAGGGCTGATGGCAGG - Intronic
1025255142 7:57379577-57379599 CTGTGCAAAGGGCCTGTGGCAGG + Intergenic
1025713582 7:63932475-63932497 GTGGGAGAAGCGCTGGTGGGGGG - Intergenic
1026602004 7:71784924-71784946 GTGTGAACAGGGCTGGGAGTTGG + Exonic
1030078018 7:105753204-105753226 GTGGGAAAAGAGTTGGGGGCTGG + Intronic
1032389085 7:131544193-131544215 ATGTACACAGGGCTGGTGGCAGG - Intronic
1034434957 7:151059200-151059222 GGGTGACAGGGGCTGGAGGCTGG - Intronic
1034576611 7:152005343-152005365 CTTAGAAAAGGGCAGGTGGCTGG - Intronic
1035375911 7:158406666-158406688 GTGTGAACAGGGCAGGTCTCAGG - Intronic
1035785017 8:2253253-2253275 GGGTGATAAGGGCTAGGGGCTGG + Intergenic
1035807794 8:2468463-2468485 GGGTGATAAGGGCTAGGGGCTGG - Intergenic
1036465240 8:8991333-8991355 GTGTGAAATGGGGAGGTGTCTGG + Intergenic
1037905596 8:22714242-22714264 GTGTGAACAGGCCTTGTGGCAGG + Intronic
1039969199 8:42307183-42307205 AGGTGAAAAGGGCTGGAGGTGGG + Intronic
1040334438 8:46408890-46408912 GAGTGAAGTGGGCGGGTGGCAGG + Intergenic
1041321887 8:56622014-56622036 GAGTGAAAAGTGCAGCTGGCAGG - Intergenic
1043046610 8:75331902-75331924 ATGTGAAAAGGGCTCGTATCCGG - Intergenic
1044599154 8:93986218-93986240 GAGTGAGACTGGCTGGTGGCAGG + Intergenic
1045018258 8:98018347-98018369 CTGTGGAAAGGGCTGATGGCTGG - Intronic
1045167493 8:99623213-99623235 CTTTGCAAAGGTCTGGTGGCAGG - Intronic
1045488314 8:102651422-102651444 GGGGGCAAACGGCTGGTGGCTGG + Exonic
1045552271 8:103183207-103183229 GAGTGAAAATGGCTGTTGGGTGG + Intronic
1047349313 8:124058465-124058487 CTGTGAAATGGGTTGGTTGCTGG - Intronic
1047670016 8:127135949-127135971 GTGAGAAGAGGGCTGGAGGGAGG - Intergenic
1048010955 8:130455758-130455780 GTGGGAAAAGGGCTGGGGCGGGG - Intergenic
1048527059 8:135212882-135212904 GTATTAAAGTGGCTGGTGGCTGG + Intergenic
1049235681 8:141511082-141511104 GTGTGCAAAGGCCCTGTGGCAGG - Intergenic
1049393513 8:142384103-142384125 GGGTGAGAAGGGCTGGCGTCAGG + Intronic
1049446097 8:142632324-142632346 GTGGGCAAGGGGCAGGTGGCAGG + Intergenic
1049613851 8:143567892-143567914 GGGACAAAAGGGCTAGTGGCAGG + Intronic
1051425980 9:16931808-16931830 GTGTCAAAAGAGATGGAGGCCGG - Intergenic
1052880119 9:33596605-33596627 GGGTGAAAAGTGGTGGTGGGGGG + Intergenic
1053351318 9:37415121-37415143 GTGAGCAAAGGCCTGGAGGCTGG - Intergenic
1053495856 9:38547612-38547634 GGGTGAAAAGTGGTGGTGGGAGG - Intronic
1054840483 9:69733201-69733223 GTTTGGAAAGGGATGGTGGCAGG - Intronic
1055015593 9:71614451-71614473 GTGAGGAAAGGGCAGGTGGGAGG + Intergenic
1055656266 9:78453035-78453057 GTGAGGAAAGGGATGGGGGCAGG - Intergenic
1057025262 9:91730299-91730321 ATGGGAAAAGGGCTGATGGAAGG + Intronic
1057675784 9:97135132-97135154 GGGTGAAAAGTGGTGGTGGTGGG - Intergenic
1057788229 9:98104659-98104681 CTTTGAAGAGAGCTGGTGGCTGG + Intronic
1057986767 9:99724813-99724835 GTGTGCAAAGGACCTGTGGCAGG - Intergenic
1058765986 9:108183203-108183225 GTGAGCCAAGGCCTGGTGGCTGG - Intergenic
1059339792 9:113591226-113591248 GGATGGAAGGGGCTGGTGGCAGG + Intronic
1060119265 9:120972974-120972996 GTGTGAAAAGGGGCAGAGGCAGG - Intronic
1060293903 9:122330194-122330216 GTGACAAAAGTGCTGGTTGCTGG + Intergenic
1060431006 9:123551564-123551586 GTGTGTAAAGGGCTAGTGAGGGG + Intronic
1060725330 9:126002483-126002505 GTGTGACAACTGCTGGTGGTGGG + Intergenic
1060896048 9:127218305-127218327 GTGTGCAGAGGGTGGGTGGCTGG - Intronic
1061448164 9:130653593-130653615 GTGTGCCAGGGGCTGGTGGTGGG - Intergenic
1061940252 9:133880155-133880177 GTGGGCAAGGGGCTGGTGGAGGG - Intronic
1062047930 9:134432966-134432988 GCGTGATAGGGGCAGGTGGCTGG + Intronic
1062135499 9:134925273-134925295 GGGAGAAAAGGGAGGGTGGCAGG - Intergenic
1062388622 9:136325191-136325213 GTGTGACAAGGCCAGGTGACAGG - Intergenic
1062548104 9:137072760-137072782 GTATGAAAAAGACTGGAGGCCGG + Intergenic
1062570504 9:137182928-137182950 GTGTGACAAGGACAGGTGCCCGG + Intronic
1203430953 Un_GL000195v1:90945-90967 ATGTGAAAAGAGCTGGTTCCCGG + Intergenic
1203435557 Un_GL000195v1:133682-133704 ATGTGAAAAGAGCTGGTTCCCGG - Intergenic
1203574179 Un_KI270744v1:161397-161419 ATGCGAGATGGGCTGGTGGCAGG - Intergenic
1186708868 X:12171959-12171981 GTGTGTTAAGGGCTGATGGGAGG - Intronic
1190137055 X:47807029-47807051 TCGTGGAAAGGGCTGGGGGCAGG + Intergenic
1190516939 X:51233661-51233683 GTTTGAAGAGGGTTGGTGGTAGG - Intergenic
1191699191 X:64021286-64021308 ATGTGCAAATGGCTGGTGACAGG - Intergenic
1192072878 X:67959796-67959818 GTGAGAAAAGGGCTAGGGACTGG - Intergenic
1195323092 X:103736868-103736890 GGTTGAAGAGGGTTGGTGGCAGG - Intergenic
1199235264 X:145485405-145485427 GAGTGAAAAGGACTTGTGGAAGG + Intergenic