ID: 1089221202

View in Genome Browser
Species Human (GRCh38)
Location 11:116873461-116873483
Sequence GGCTCTGTGCTGCTACTCAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 171}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089221194_1089221202 29 Left 1089221194 11:116873409-116873431 CCAACCCCAGGCTCACAACCTTT 0: 1
1: 0
2: 2
3: 18
4: 310
Right 1089221202 11:116873461-116873483 GGCTCTGTGCTGCTACTCACTGG 0: 1
1: 0
2: 2
3: 20
4: 171
1089221193_1089221202 30 Left 1089221193 11:116873408-116873430 CCCAACCCCAGGCTCACAACCTT 0: 1
1: 0
2: 2
3: 29
4: 246
Right 1089221202 11:116873461-116873483 GGCTCTGTGCTGCTACTCACTGG 0: 1
1: 0
2: 2
3: 20
4: 171
1089221198_1089221202 11 Left 1089221198 11:116873427-116873449 CCTTTTTATCAAAAGCCTCTGAG 0: 1
1: 0
2: 2
3: 27
4: 221
Right 1089221202 11:116873461-116873483 GGCTCTGTGCTGCTACTCACTGG 0: 1
1: 0
2: 2
3: 20
4: 171
1089221196_1089221202 24 Left 1089221196 11:116873414-116873436 CCCAGGCTCACAACCTTTTTATC 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1089221202 11:116873461-116873483 GGCTCTGTGCTGCTACTCACTGG 0: 1
1: 0
2: 2
3: 20
4: 171
1089221195_1089221202 25 Left 1089221195 11:116873413-116873435 CCCCAGGCTCACAACCTTTTTAT 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1089221202 11:116873461-116873483 GGCTCTGTGCTGCTACTCACTGG 0: 1
1: 0
2: 2
3: 20
4: 171
1089221197_1089221202 23 Left 1089221197 11:116873415-116873437 CCAGGCTCACAACCTTTTTATCA 0: 1
1: 0
2: 0
3: 20
4: 217
Right 1089221202 11:116873461-116873483 GGCTCTGTGCTGCTACTCACTGG 0: 1
1: 0
2: 2
3: 20
4: 171
1089221201_1089221202 -4 Left 1089221201 11:116873442-116873464 CCTCTGAGACAGTGAATTGGGCT 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1089221202 11:116873461-116873483 GGCTCTGTGCTGCTACTCACTGG 0: 1
1: 0
2: 2
3: 20
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089221202 Original CRISPR GGCTCTGTGCTGCTACTCAC TGG Exonic
900103075 1:971055-971077 GGCTCTGACCTCCTCCTCACAGG + Intronic
900472313 1:2860995-2861017 GCCTCTGTGCTGCTTCCCTCTGG + Intergenic
900969809 1:5985337-5985359 GCTTCTGTGCTGCTGCCCACGGG - Intronic
903106357 1:21083755-21083777 GGCAGTGTGCTGTTGCTCACAGG + Intronic
904006736 1:27366849-27366871 GGCTCTGAGCTGCCGATCACCGG - Exonic
906041002 1:42787758-42787780 GCCTCTGTGCTACTTCACACTGG - Intronic
907809659 1:57856069-57856091 GGGTCTGAGCTGCTACTGCCTGG + Intronic
910015420 1:82517752-82517774 GGCCCGGTGCTGCCACTCCCAGG - Intergenic
915087574 1:153398546-153398568 GCCTCTGTGCAGCTCCTCTCTGG + Intergenic
917962878 1:180158362-180158384 GGCTCTGTGCTGGGAATCACAGG - Intronic
918107995 1:181429674-181429696 GGCTCTGTCCTGCTTCCCCCAGG + Intronic
919850230 1:201667501-201667523 GTCTCTGATCTGCCACTCACCGG - Intronic
919865878 1:201782589-201782611 GGGTCAATGCTGCTGCTCACAGG - Exonic
920044675 1:203125688-203125710 GGCTCTACTCTGCCACTCACTGG - Intronic
920335826 1:205244533-205244555 GGCTCTGAGCAGGAACTCACGGG + Intronic
924202789 1:241677283-241677305 TGTTCTGTTCTGCTACTCACCGG + Intronic
1062819874 10:526848-526870 GGCTCTGTCCTGCCAGTCCCCGG + Intronic
1064658220 10:17578088-17578110 GGATCTGTGCTGCCAATCTCGGG - Intergenic
1065313930 10:24443322-24443344 ATCTCTGTTCTGCTACTCTCTGG - Intronic
1071299449 10:84245342-84245364 GGCAGTGTGCTGCACCTCACAGG - Intronic
1072719313 10:97771100-97771122 GGCACTATGCTGCCACTCCCTGG + Intronic
1073625946 10:105097055-105097077 TGCTCTGTGCTGCTTCTCTGGGG - Intronic
1076355875 10:129852899-129852921 TGCTCTCGGCTGCTGCTCACAGG - Intronic
1076797351 10:132804810-132804832 GGCTCTGGGCCGCCACTCACAGG - Intergenic
1077186301 11:1236854-1236876 GGCTCTGTGCTGCCTCCCACGGG + Intronic
1078847316 11:15129985-15130007 GGCTGTGTGCTGTTATGCACAGG + Intronic
1081673657 11:44955866-44955888 TGCTCTGTGCTGGTACTGAAGGG + Intergenic
1081799504 11:45848016-45848038 GCCCCTGTTCTGCCACTCACTGG - Intronic
1085455266 11:76661878-76661900 AGCTCTGCCCTGCTGCTCACTGG - Intronic
1087173450 11:95074380-95074402 GGCTCTGTGCTATTCCTCACTGG + Intergenic
1088884489 11:113996421-113996443 GGCTCTGAGGTGCTCCTCAATGG + Intergenic
1089221202 11:116873461-116873483 GGCTCTGTGCTGCTACTCACTGG + Exonic
1090394008 11:126407240-126407262 ACCTCTGTGCAGCTACTCCCGGG + Exonic
1091631293 12:2162853-2162875 GGCTTTGTGCTGGTTCTCAATGG - Intronic
1092261292 12:6954572-6954594 GACGCTGAGCTGTTACTCACTGG - Intronic
1093621699 12:21298262-21298284 GGCTCTGTGCTTTTTCTAACAGG - Intronic
1095824529 12:46517161-46517183 GGCTCTGTGCTGTTCCCCAGTGG + Intergenic
1099218944 12:79889413-79889435 GGCTCTGAGCTGCTCCCCACTGG + Intronic
1104366731 12:128184752-128184774 GACTCTGTGCCTCTTCTCACAGG - Intergenic
1105581703 13:21704116-21704138 GGCTCAGGGCTGCCATTCACTGG - Exonic
1106086238 13:26544454-26544476 GGGTCAGTGCTGCTGCTCAGAGG + Intergenic
1107654926 13:42582099-42582121 GCCTCTGTGTTGCAACTCCCTGG + Intronic
1107815964 13:44244486-44244508 GGCTCTGTGCTGGGACACACTGG - Intergenic
1108476677 13:50826087-50826109 GGTTGTGTGCTCCTTCTCACAGG - Intronic
1108479664 13:50856041-50856063 GGCTCTGTGCTGCTCCTGGGTGG - Intergenic
1109534602 13:63699947-63699969 GGCTCTGGGCTGGTACTGAGGGG + Intergenic
1109816161 13:67588371-67588393 AGCTCTGTTCTGCAACTCCCAGG + Intergenic
1112822087 13:103349352-103349374 GGCTGTGTGTTTCAACTCACAGG + Intergenic
1113065848 13:106373926-106373948 GGCTCTGATCAGCTTCTCACTGG - Intergenic
1113453312 13:110428581-110428603 GGCGCTGTGGGGATACTCACGGG - Exonic
1113630761 13:111882049-111882071 GCTTCTTTGCTGCTGCTCACAGG - Intergenic
1114486797 14:23067662-23067684 GGATCATTCCTGCTACTCACAGG - Intronic
1114532323 14:23403695-23403717 GCCTCCCTGCTGGTACTCACAGG + Exonic
1116380705 14:44264277-44264299 GGCTCTGTGTTGCCATTCAAGGG + Intergenic
1118680160 14:68232794-68232816 AGCTCTGAGCTTTTACTCACAGG + Intronic
1119210992 14:72831633-72831655 GGCTCAGTGCTGCTACTGACGGG - Intronic
1120282997 14:82463301-82463323 GGCTCTGTGCTGCTTCCAGCTGG - Intergenic
1121224277 14:92309780-92309802 GACTCTGTGCAGCTGCCCACAGG + Intergenic
1122289938 14:100675132-100675154 GGCTCTGAGATGCTCCCCACTGG + Intergenic
1123139716 14:106063043-106063065 GGCCCTGTGCTTCTCGTCACTGG + Intergenic
1123156950 14:106235954-106235976 GGCCCTGTGCTCCTCGTCACTGG + Intergenic
1123490517 15:20776103-20776125 GGCTCAGTGCTGATTCTCGCGGG + Intergenic
1123547018 15:21345190-21345212 GGCTCAGTGCTGATTCTCGCGGG + Intergenic
1125159557 15:36627578-36627600 GGCACCATGCTGATACTCACTGG - Intronic
1125216740 15:37283607-37283629 GGCTCTGTGCTGCTCCTGGATGG + Intergenic
1125587133 15:40828848-40828870 GGCTCTGGAGTGCCACTCACTGG - Intergenic
1128359030 15:66947769-66947791 GTCTCTTTGCTGCAACCCACAGG + Intergenic
1128520639 15:68372479-68372501 GGCTGTGTGCTGTGAGTCACTGG + Intronic
1128715190 15:69902891-69902913 ATCTCTGTGCTGCTACTTCCTGG - Intergenic
1129451314 15:75652750-75652772 GGCTCTGCACTGCTCCTCCCAGG + Intronic
1129559800 15:76553680-76553702 GGCTGTGTGCTCTTACTCTCGGG - Intronic
1130572786 15:85063432-85063454 GGCACTGGGCTGCTACCCAGGGG - Intronic
1202955350 15_KI270727v1_random:72406-72428 GGCTCAGTGCTGATTCTCGCGGG + Intergenic
1133262185 16:4558100-4558122 GCCTCTTTGCTGCTCCTCACAGG - Intronic
1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG + Intronic
1134008982 16:10837241-10837263 TGCACTGTGCTGCTTCTCCCAGG + Intergenic
1135498177 16:22970724-22970746 TGCTCTGTGCTGTCACTCCCTGG + Intergenic
1135589669 16:23695874-23695896 GGCTCCTGGCTGCCACTCACCGG + Exonic
1136248027 16:28986214-28986236 GGGGCTGAGCAGCTACTCACGGG - Exonic
1139701671 16:68711576-68711598 GCCTCTGTTCTGCTTCCCACTGG + Intronic
1141660411 16:85438311-85438333 GGGTCTGTGCTGCTCCTTGCTGG + Intergenic
1141767905 16:86070786-86070808 GCCTGTGAACTGCTACTCACGGG - Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143687002 17:8525313-8525335 GTTTCTGTGCTTCTTCTCACTGG + Intronic
1143893800 17:10121439-10121461 GGCCTGGTTCTGCTACTCACTGG + Intronic
1143994277 17:10993311-10993333 GTCTCTGTGCTGCTCCTCCCAGG + Intergenic
1144211094 17:13016459-13016481 TGCTCTGTGCTGCTGCTGACTGG + Intronic
1151974657 17:77477566-77477588 GGGTGTGTTGTGCTACTCACGGG + Intronic
1160408100 18:78656573-78656595 GGCTGGGTGCTGGTGCTCACAGG - Intergenic
1164740498 19:30572242-30572264 GTCTGTGTGCTGCGTCTCACGGG + Intronic
1165259100 19:34597749-34597771 CGCTCTCTGCTGCTGCTCACAGG - Intronic
1165808586 19:38596787-38596809 GGCTCAATGCTGCCACTCCCTGG - Intronic
1167529050 19:50003433-50003455 GACCCTGAGCTGCTGCTCACGGG + Intronic
927642219 2:24852502-24852524 TGCCCTGTGCTACTCCTCACAGG + Intronic
927889940 2:26741964-26741986 AGCTCTTAGCTGTTACTCACAGG + Intergenic
928126570 2:28620641-28620663 CTCTCTGGGCTGCTACTTACTGG - Exonic
929414499 2:41733616-41733638 AGCTCTGTGCACCCACTCACTGG + Intergenic
932372623 2:71204801-71204823 GTCTCTGTGCTCTTACTTACAGG - Intronic
933689845 2:85171481-85171503 TGGTGTGTACTGCTACTCACAGG + Intronic
934548576 2:95240333-95240355 GGCTCTGTGCTGCTCCTGTGTGG - Intronic
934963300 2:98696705-98696727 TGTTATGTGCTGCTAATCACTGG + Intronic
938502310 2:131836424-131836446 GGCTCTCTGCTGCTGCTGATGGG + Intergenic
939702055 2:145404812-145404834 TGCTGTGTGGTGCTACCCACGGG + Intergenic
940982967 2:160023911-160023933 GGCTCTGAGCTGCTTATAACGGG - Intronic
945302009 2:208223298-208223320 ACCTCTGTTCTGCTACTTACTGG + Intergenic
1169068596 20:2708116-2708138 TGCTCTCTGCTGCTGCTCCCTGG + Intronic
1172817070 20:37695669-37695691 GTCTCTGTTTTGCTACTAACTGG + Intronic
1173333542 20:42095399-42095421 GCCTCTGTGCTGTTCCTCAAGGG + Intronic
1178061358 21:28856673-28856695 GGCTCTGTGCTGCTCCTGGGTGG - Intergenic
1181688959 22:24547757-24547779 GCCTCTCTGCTGCTGCTCCCTGG + Intronic
1182759989 22:32714734-32714756 GGCTTTGTGCTGCTACTTCCTGG + Intronic
1183411583 22:37658050-37658072 GGATCTGTCCTGCTACACATCGG + Intronic
1184067591 22:42129287-42129309 GGCTCTGTCCAGCTGGTCACAGG + Intronic
1184182551 22:42840359-42840381 GGCTCTCTGCTTCTTCTCATAGG + Intronic
1184633645 22:45807303-45807325 GGCACTGTGCTGCGCATCACCGG + Intronic
950677984 3:14565987-14566009 GCCTCTGTGCTGTGACCCACAGG - Intergenic
954339375 3:49940523-49940545 GGCTCTGTGCTCCTACTCTTCGG + Intronic
955165170 3:56503737-56503759 GGCTCTGTGATTCTATACACTGG + Intergenic
956717644 3:72092474-72092496 GTCTCTGTGCTTCTTCTGACAGG - Intergenic
960823696 3:121760518-121760540 GGCTCTGTTCTGGTATTCAAAGG + Intergenic
968929926 4:3573423-3573445 GCCTCTGTGCTGCCACTCAGGGG + Intergenic
970353998 4:15234388-15234410 GGCTCTTTGCTGCCAATCTCTGG + Intergenic
971318435 4:25586198-25586220 GGCTTCCTGCTGCTACTCTCAGG - Intergenic
977295293 4:95202781-95202803 GCCCCTGTGCTGCTCCTCGCTGG - Exonic
977633077 4:99264225-99264247 AGCTCTGGTCTGCTACTCCCAGG - Intergenic
977668686 4:99670866-99670888 GGCTCTGTGCTGCTCCTGCGTGG - Intergenic
984598294 4:181696914-181696936 GGCTCTGTCCTCCTGTTCACTGG - Intergenic
985570129 5:640228-640250 GGCTCTGTGCGTCCACACACGGG - Intronic
985599758 5:821159-821181 GGCTCTCTGCTGCTCCCCCCGGG + Intronic
986652775 5:9980696-9980718 AACTTTGTGCTTCTACTCACAGG - Intergenic
986843021 5:11720064-11720086 ATCTCTGTGCTGCCACCCACTGG + Intronic
987469059 5:18308340-18308362 TGCTGTGAGCAGCTACTCACAGG - Intergenic
989506432 5:42231281-42231303 AGCGCAGTGCTGCTACTGACTGG + Intergenic
996080864 5:119256392-119256414 GGCTCTGGGCTGCTACTGGGGGG - Intergenic
997311241 5:132885407-132885429 GGCTCACTGCAGCTACTCCCAGG - Intronic
997943746 5:138181284-138181306 GTCTCTGTGCAGCTACTCTTTGG - Intronic
999367628 5:151033440-151033462 GGCTCTGGGCTGCTACCCAGGGG - Intronic
1002131982 5:177087320-177087342 GGCCCTGTGCAGCTACCCTCGGG + Intronic
1002526865 5:179819970-179819992 GGTTCTGACCTCCTACTCACAGG + Intronic
1003616365 6:7658584-7658606 GTCTCTGTGCTGCTGCTGGCAGG + Intergenic
1006181182 6:32154269-32154291 GGGCCTGGGCTGCTGCTCACGGG + Exonic
1006525242 6:34598973-34598995 TGCTCTGTGTTGCTTCTTACCGG + Intronic
1006819433 6:36879960-36879982 TGCTCTGTGCTGTGGCTCACTGG + Intronic
1007633228 6:43284078-43284100 GGCACGGCGCTGCTCCTCACTGG - Exonic
1007777016 6:44229528-44229550 GACTCTGTGCTGGTAGGCACAGG + Intronic
1009800183 6:68527487-68527509 GGCTCTGGGCTGGTACTCGGGGG + Intergenic
1013111832 6:107070441-107070463 GGCTGTGAGCTGGTACTCAGGGG + Exonic
1014815212 6:125927949-125927971 GGCTCTGACCTGCGACTCTCTGG - Intronic
1014897710 6:126923418-126923440 GGCATGGTGCTGTTACTCACAGG - Intergenic
1015281816 6:131442532-131442554 GGGTCTGTGCTGCACCTGACAGG - Intergenic
1017574353 6:155785839-155785861 GGATCTTAGCTGCAACTCACTGG - Intergenic
1017644717 6:156528065-156528087 GCCTCTGTGGTGTTAATCACAGG - Intergenic
1018034212 6:159867519-159867541 GGCTCTGTGCTGCTGTGCAGTGG + Intergenic
1018063814 6:160111615-160111637 GGGTCTGTGCTCCTAATCCCTGG + Intronic
1022596504 7:31718366-31718388 GGCTCTCCTCTGCTACTCACAGG + Intergenic
1025164915 7:56704095-56704117 GGCTCTGTTCTCCTGCACACAGG - Intergenic
1025747360 7:64255124-64255146 GGCTCTGTTCTCCTGCACACAGG + Intronic
1033564964 7:142569620-142569642 GGCTCTGTGCTGCTCCTGGTGGG - Intergenic
1034678234 7:152908057-152908079 GGCTCGGTGATTCTGCTCACCGG - Intergenic
1035777853 8:2203373-2203395 GGCTCTGCTCTGCCACTCAGTGG + Intergenic
1037110985 8:15164337-15164359 GGCTGGGAGCTGCTGCTCACCGG - Intronic
1037320753 8:17640580-17640602 GGCTCTGGGCTGGTACTTAGTGG + Intronic
1039506696 8:38057376-38057398 GGCTCTGAGCTGCTCCTTAGAGG - Intronic
1040565695 8:48564809-48564831 GGCACTGTGCTGCTCCTCTTGGG + Intergenic
1041212816 8:55569716-55569738 GGCTCGGTGCTTCTGCTCACAGG - Intergenic
1041726579 8:61023659-61023681 CGCTCCGAGCTGCGACTCACCGG - Intergenic
1043210266 8:77505132-77505154 GGCTCAGAGATGCTACTGACGGG + Intergenic
1048199025 8:132356117-132356139 GGCTCTGTGCTGAGAGTCTCAGG - Intronic
1048283403 8:133122445-133122467 GGCTCCAGACTGCTACTCACTGG - Intronic
1050348601 9:4718064-4718086 TGCTCTGGGCTTCTATTCACTGG + Intronic
1051168019 9:14286313-14286335 GACTCTGCGCTGCTCCTAACTGG - Intronic
1052827571 9:33188097-33188119 GGATCTGGGATGCTACCCACTGG - Intergenic
1056810416 9:89759602-89759624 CCCTCTGTGCTGCTACCCAAGGG - Intergenic
1056910426 9:90695582-90695604 GTCTCTGTGCTGCTAGTCCCTGG + Intergenic
1059331129 9:113536507-113536529 GGCTCTGTCCTGCTCTCCACAGG + Intronic
1060931298 9:127491141-127491163 AGTTTTGTGCTGCTACTCTCTGG - Intronic
1061607857 9:131724976-131724998 GGCTCCGTGCCCCTTCTCACAGG - Intronic
1062005452 9:134236462-134236484 GGCTTTGTGCTGCCACTCTGGGG + Intergenic
1062170611 9:135132857-135132879 TGCTCTGTCCTGCTAGTCTCGGG - Intergenic
1062609851 9:137368946-137368968 GGCCCTGTGCCCCTCCTCACGGG - Intronic
1186865869 X:13720331-13720353 GTGTCCGTGCTGCTACTAACTGG - Intronic
1186886713 X:13921529-13921551 TGCTCTGAGCTGCTACTCTCTGG - Intronic
1189268695 X:39735613-39735635 GGCTCTGTGCCTCTCCTCGCTGG - Intergenic
1190054159 X:47172200-47172222 AGCTCTGCTCTGCCACTCACTGG - Intronic
1194594252 X:95837498-95837520 GGCTCTGTGCTGCTCCCCACTGG + Intergenic
1195106387 X:101605906-101605928 GGCTCTCTCCTGCTAGTCAGGGG + Intergenic
1198686983 X:139237647-139237669 GGCTCTGTGCTGCTCCCCGGTGG - Intergenic
1198759776 X:140019143-140019165 GCCTCTGAGCTGCTACTCTGGGG - Intergenic
1198779009 X:140214907-140214929 GCCTCTGAGCTGCTACTCTGGGG + Intergenic
1198822849 X:140667415-140667437 TTTTGTGTGCTGCTACTCACTGG + Intergenic
1198975825 X:142334066-142334088 GGCTGTGTGGTGCAACTCACAGG - Intergenic
1199108973 X:143907743-143907765 GGCTGTGTGCTAATACTCAAAGG - Intergenic
1200211178 X:154347201-154347223 GGCTCAGGGCGGCCACTCACTGG - Intergenic
1200219674 X:154384891-154384913 GGCTCAGGGCGGCCACTCACTGG + Intergenic