ID: 1089227357

View in Genome Browser
Species Human (GRCh38)
Location 11:116936852-116936874
Sequence CATGCTGTACACTTTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089227354_1089227357 5 Left 1089227354 11:116936824-116936846 CCTGCATGTGTACTTGCTGTTTC 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1089227357 11:116936852-116936874 CATGCTGTACACTTTGCTCAGGG 0: 1
1: 0
2: 1
3: 18
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089227357 Original CRISPR CATGCTGTACACTTTGCTCA GGG Intronic
903094535 1:20957392-20957414 AGTGCTGTAAACTTTGCTCTTGG - Intronic
906946501 1:50298861-50298883 CATGCTGTTCCTTTTGCCCATGG + Intergenic
912191449 1:107345724-107345746 CAGGCAGTACACTTTTCTTATGG - Intronic
919222616 1:194649651-194649673 TATGCTGTACACTTTGATAAAGG + Intergenic
1065118445 10:22505011-22505033 CCTGATGTACACATTGCTGATGG - Intergenic
1068702907 10:60038872-60038894 CATGTTGTACCCTTTGCTTGGGG + Intronic
1074679003 10:115883940-115883962 CTTGGTGTCCACTCTGCTCATGG + Intronic
1075158131 10:119997716-119997738 TTTGCTGGACACTTTGCTCAGGG + Intergenic
1076611518 10:131728933-131728955 CAGGATGTACACTTGGCTCACGG - Intergenic
1077932445 11:6748197-6748219 CATGGTTTCCAGTTTGCTCATGG - Intergenic
1078597137 11:12697177-12697199 CATGCCTTCCACATTGCTCAGGG - Intronic
1080635427 11:34119298-34119320 CATGCTGCTCATTTGGCTCAGGG - Intronic
1081506746 11:43725219-43725241 AAAGCTGAACAGTTTGCTCAAGG - Intronic
1081709535 11:45208032-45208054 CATGCTGTGCCCCTTGCCCAGGG + Intronic
1085114600 11:73919699-73919721 CTTAATGTACACTTTGCTCCAGG - Intronic
1085935271 11:81134084-81134106 CAAGCTGTACATTTTGGGCAGGG - Intergenic
1089227357 11:116936852-116936874 CATGCTGTACACTTTGCTCAGGG + Intronic
1090081516 11:123616524-123616546 CATGCTATACAATTTGCTCAGGG - Intronic
1092344370 12:7703279-7703301 CATACTGTACACTTTGATTTTGG + Intergenic
1093199839 12:16173221-16173243 CATCCTGTACAGTTTGCACAGGG + Intergenic
1095082425 12:38020751-38020773 CACTCTGTACAATTTGCTAAGGG + Intergenic
1098259188 12:68650397-68650419 CAGACTGTACAATTTGTTCAAGG + Exonic
1098561996 12:71884948-71884970 CCTGCTCTACACTTTCATCAAGG + Exonic
1099824471 12:87756972-87756994 AATGCTGTATGCTTTTCTCAGGG - Intergenic
1100382416 12:94074110-94074132 CATGCTCCACACTTTTCTCAAGG - Intergenic
1101894529 12:108745941-108745963 CAGGTTGCACACTTGGCTCAGGG + Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102535480 12:113577506-113577528 CATGGTGTACCCTCAGCTCATGG + Intergenic
1104105094 12:125651689-125651711 CCTGCTGTATTCTGTGCTCAGGG + Intronic
1104760353 12:131294265-131294287 CAGAGTGTCCACTTTGCTCATGG + Intergenic
1104819415 12:131666382-131666404 CAGAGTGTCCACTTTGCTCATGG - Intergenic
1106347408 13:28892381-28892403 CTTGCTGTTCACCTTGCCCAGGG - Intronic
1106764486 13:32900231-32900253 GAGGCTGTACGCTTGGCTCACGG + Intergenic
1108186678 13:47894835-47894857 CCTGCTGTACCCTTAGCTGACGG - Intergenic
1111009110 13:82288615-82288637 CATGCTCCACATTTTGCTTATGG + Intergenic
1115906788 14:38210058-38210080 CGTGTTGTACACATTTCTCATGG + Exonic
1116897496 14:50331458-50331480 CATGCTGTACTTGTTCCTCATGG + Exonic
1118004349 14:61552399-61552421 CATGCTGCCCACTGTGCTGAGGG - Intronic
1119176848 14:72574798-72574820 CACACTGCACACTCTGCTCATGG - Intergenic
1120238936 14:81927036-81927058 TAAGCTGTTCACTTTGTTCATGG - Intergenic
1121085968 14:91146368-91146390 CATGCTGGAAATTGTGCTCAGGG - Intronic
1122589433 14:102836143-102836165 CAGGCAGTACACCTTGCACACGG - Intronic
1123057356 14:105577650-105577672 CGTGCCCTACACTCTGCTCATGG - Intergenic
1125237931 15:37537706-37537728 AATCCTGTCCACTTTGATCAAGG - Intergenic
1127871497 15:63077619-63077641 CATGCTCTATAATTTTCTCAGGG + Intergenic
1128118246 15:65126305-65126327 CATGCTGTACAATCTCCTTAAGG + Intronic
1128891262 15:71333704-71333726 CTTGCTTCACACTTTACTCAAGG + Intronic
1135130173 16:19847167-19847189 GATGCTGGACACTAGGCTCAGGG - Intronic
1137743957 16:50807334-50807356 GATGCTGTAGATTTTGCACAGGG - Intergenic
1139748876 16:69096476-69096498 CATGGTGTGATCTTTGCTCACGG - Intergenic
1142942911 17:3397921-3397943 CATGTTACACACTTTACTCATGG - Exonic
1142946445 17:3433325-3433347 CATGTTACACACTTTACTCATGG - Exonic
1144391379 17:14796694-14796716 CATGGTCTGCACTTTGCTGAGGG + Intergenic
1146780257 17:35664400-35664422 CATGCTGCACACATGGCTAATGG + Intronic
1146964150 17:37010617-37010639 CTTACTGTACACTGTACTCATGG - Intronic
1148637478 17:49159773-49159795 CATGCTGTGCGCTTTGCACCTGG + Intronic
1152246492 17:79187353-79187375 CAAGCTGCACACTGTCCTCACGG - Intronic
1155352202 18:24917735-24917757 CAATCTTTACATTTTGCTCAGGG + Intergenic
1155638490 18:27983687-27983709 CATGTTTTACACTTTGCGCCAGG + Intronic
1163638235 19:18447475-18447497 CATCATGGACACTTTGCTCATGG - Intronic
1167941741 19:52952460-52952482 CATGCTGACCATTCTGCTCAGGG + Intronic
1168699466 19:58428065-58428087 CCTGCTGTAAACTTTGCTGACGG + Intergenic
925783894 2:7409208-7409230 CATGCTGCACACAGAGCTCAAGG - Intergenic
926212879 2:10884228-10884250 CACACTGTACACTTTCCACAAGG + Intergenic
926772360 2:16389723-16389745 CAGGCTGGACACATGGCTCAGGG - Intergenic
927336879 2:21935348-21935370 CATGCTCTTCAATTTTCTCAGGG - Intergenic
929822605 2:45285367-45285389 CATGATGAACACTGGGCTCAAGG - Intergenic
930272300 2:49271056-49271078 CATGCTGTACACCTTACTGAGGG - Intergenic
930346561 2:50189877-50189899 CATGCTATACAGTTTGCACATGG + Intronic
930481056 2:51948432-51948454 CATGATGGCCACTTTGTTCATGG + Intergenic
931578656 2:63749048-63749070 CCTCCTGTACTCTTTGCTAAAGG + Intronic
934579035 2:95423654-95423676 CATGGTATACACTGTTCTCATGG + Intergenic
934600412 2:95653049-95653071 CATGGTATACACTGTTCTCATGG - Intergenic
936533774 2:113295112-113295134 CATGGTTTACACTGTTCTCATGG - Intergenic
937232063 2:120403989-120404011 CATGCTGTGCACTTTCCCCGGGG - Intergenic
937478355 2:122235297-122235319 GATGATGGACACCTTGCTCAAGG - Intergenic
939550284 2:143606724-143606746 AAAGGTGTACACTTTCCTCAAGG + Intronic
943574141 2:189611069-189611091 CATCCTGTACACTTACCTGATGG - Intergenic
943858390 2:192828317-192828339 CCTGCTGTCCACTGTGCCCATGG - Intergenic
945158455 2:206864061-206864083 CATGCTCTATACTTTTATCAAGG - Intergenic
946385407 2:219381410-219381432 CTTGCTGTTCACCTTGATCACGG + Exonic
1168862478 20:1055654-1055676 CACACAGTACACTTTGCACAGGG + Intergenic
1168887558 20:1270213-1270235 CATGCTATGCACTTAGCCCAGGG - Intronic
1169092391 20:2869508-2869530 CCTGCTGTACAAACTGCTCAGGG - Intronic
1169642660 20:7772060-7772082 TATGCTGTTCCCTTTGCTTATGG - Intergenic
1171446953 20:25211663-25211685 GATGCTGCACACTTACCTCATGG + Intronic
1172669484 20:36625054-36625076 CATGCTGGACACTCTGCTCTGGG + Intronic
1173041906 20:39472246-39472268 CCTGCTATACTTTTTGCTCAGGG + Intergenic
1173721780 20:45264970-45264992 TATGCTGGACACTGTGCTAAAGG + Intergenic
1184302513 22:43570460-43570482 GATACTCTACACTTTGCACATGG + Intronic
1184833968 22:47009746-47009768 CCTGCTGTACAGTTTGTTGATGG - Intronic
949263688 3:2132599-2132621 CATGCTGTACTCTCTGGACAGGG + Intronic
950709738 3:14805727-14805749 CATGCTGCACACATTGCTGGAGG - Intergenic
951987754 3:28639916-28639938 CATGTTGAACACTTAGCACAGGG + Intergenic
952813066 3:37422460-37422482 CATGCTATCCACTTTGCAGAAGG + Intronic
952998496 3:38908364-38908386 CATACTGGACACTGTGCTAAGGG - Intronic
953122960 3:40063965-40063987 CCTGCTGTACACTCTTCTCATGG - Intronic
959857209 3:111173762-111173784 TAGGCTGTACACTTTACTAAAGG - Intronic
965686357 3:171306957-171306979 CATGCTGTTGACTTTGTTCCCGG - Intronic
966445806 3:179999381-179999403 CATTATGTCCACTTTGTTCATGG - Intronic
968740782 4:2330793-2330815 CATGCTGTCCCCTTCGCTCAGGG - Intronic
971462558 4:26916783-26916805 CATGCTGTTCTCTCTTCTCAAGG + Intronic
972395549 4:38656251-38656273 CAGGGTGTACACTGTGCTCTAGG - Intergenic
975106980 4:70578793-70578815 CAGGCTGTCTACTTTGCTCTGGG - Intergenic
976187686 4:82458724-82458746 CACGATGAAAACTTTGCTCAGGG + Intronic
980428707 4:132661592-132661614 AATGCACTACACTGTGCTCAGGG - Intergenic
982976947 4:162075766-162075788 GATGCTGCACACTTTCCTTAGGG + Intronic
984440755 4:179766908-179766930 AATGCTGGACAAGTTGCTCACGG - Intergenic
989702334 5:44284736-44284758 TATGCTGGACACTTTGCTAAAGG - Intergenic
990967979 5:61470342-61470364 CATTCTGTACATTTAGTTCAAGG - Intronic
994720886 5:103379087-103379109 CATGATTTCCACTTTGCTAATGG + Intergenic
995015803 5:107307329-107307351 CAAGCTGGTCACTTGGCTCAAGG - Intergenic
995134405 5:108665295-108665317 AATGCTGTACACATTGAACATGG - Intergenic
1001204041 5:169745473-169745495 TATGGTTTACACTTTGCCCAAGG + Intronic
1005064923 6:21808423-21808445 CATGCTGTAAACTTTGGTAGTGG + Intergenic
1005480334 6:26249435-26249457 GAAGCTGTACACTATGCTCAGGG - Intergenic
1006471811 6:34233915-34233937 CAGTCTATACAGTTTGCTCAAGG - Intergenic
1007995058 6:46298449-46298471 TATGCTGTATTCTTTGCTAATGG + Intronic
1011436462 6:87343417-87343439 CTTGTGGTACACTTAGCTCAGGG + Intronic
1012601259 6:101100018-101100040 CTTGCTTTACTTTTTGCTCATGG + Intergenic
1012721030 6:102745635-102745657 CATGCTTTATACTGTGCTAATGG - Intergenic
1013103576 6:107007894-107007916 CATGCTGTTCACGTGGCCCAGGG + Intergenic
1014523615 6:122474849-122474871 CCTGCTTTACATTTTTCTCAGGG - Intronic
1014785381 6:125612395-125612417 GATGCTGTACTTTTCGCTCAAGG + Intergenic
1015083423 6:129256213-129256235 TATGCTGCACCCTTTGCTAATGG + Intronic
1016261595 6:142177456-142177478 CATGCTAGGCACTTTGCTAAAGG - Intronic
1016887891 6:148975492-148975514 CACACTGGACACTTTGATCATGG - Intronic
1017455135 6:154594642-154594664 CATGCTGTCCACTCAGCTTATGG - Intergenic
1018193791 6:161336656-161336678 TATGCTTTAGATTTTGCTCACGG - Intergenic
1018305957 6:162455437-162455459 CATGCTGTACACGTTGCCTTGGG - Intronic
1020460738 7:8426904-8426926 CATCCTCTCCACTTTTCTCAGGG - Intergenic
1021631282 7:22649836-22649858 CATGGTGTACACATTAATCAAGG - Intergenic
1024577514 7:50776604-50776626 CATACTGAATACTATGCTCACGG + Intronic
1024827053 7:53402587-53402609 AAGTCTGTACACTTTCCTCAGGG + Intergenic
1025115065 7:56250642-56250664 CATGCTGAAGAGTTTACTCATGG + Intergenic
1029587956 7:101487302-101487324 CCAGCTTTACCCTTTGCTCATGG + Intronic
1031155876 7:118111507-118111529 CATCCTGTACAATTGGCCCAGGG + Intergenic
1037672499 8:21027390-21027412 CATGGTGAACACTTGGCTTAGGG + Intergenic
1039434220 8:37548484-37548506 CATGCTGGATCCTTTGATCAGGG - Intergenic
1041847899 8:62352724-62352746 CATGATGTACAGTGTCCTCATGG - Intronic
1043326951 8:79063979-79064001 AATGTGGTACACTTAGCTCAGGG - Intergenic
1043915033 8:85912489-85912511 AATGCTGTATATTTTGCACATGG + Intergenic
1046238659 8:111462198-111462220 CATGCTGAATACCTAGCTCAAGG + Intergenic
1046651421 8:116840442-116840464 TCTGCTGTACACTCTGCTCAAGG + Intronic
1049659778 8:143814792-143814814 CTTGATGTACTCTTTGCTCTCGG - Intronic
1052368765 9:27641657-27641679 CATGATGACCACTTTGTTCATGG - Intergenic
1056045521 9:82711562-82711584 CATGATGGCCACTTTGTTCATGG + Intergenic
1057139611 9:92718550-92718572 CACGCTGCGCACTGTGCTCAAGG - Exonic
1057793805 9:98141683-98141705 CATCCTGTACACTGTCCTCAAGG + Intronic
1058873278 9:109220704-109220726 CCTCCTGGAGACTTTGCTCAAGG + Intronic
1186329496 X:8517141-8517163 CATGCTATACACTTTATTCAAGG - Intergenic
1186976291 X:14909033-14909055 TAGGCTGTATACTTTCCTCAAGG + Intronic
1186979328 X:14942091-14942113 CATGCTGTAGACATGGCTAAAGG + Intergenic
1191911962 X:66160895-66160917 CATGCTGAGCACTGTGCTAAGGG + Intergenic
1194443648 X:93961921-93961943 CATCCTGTCCACTTTGTTCATGG - Intergenic
1199723786 X:150562846-150562868 CAACCTGTACACTCTGCTCCTGG - Intergenic
1201351254 Y:13044116-13044138 AATGCTGTAAACTTTCCTCTTGG - Intergenic
1201399956 Y:13594405-13594427 CATGTTGAAGAGTTTGCTCATGG - Intergenic