ID: 1089237243

View in Genome Browser
Species Human (GRCh38)
Location 11:117040693-117040715
Sequence GAAGACTTACCATGGAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089237240_1089237243 21 Left 1089237240 11:117040649-117040671 CCACATACAGAATATAATCATGG 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1089237243 11:117040693-117040715 GAAGACTTACCATGGAAGACTGG 0: 1
1: 0
2: 0
3: 9
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089237243 Original CRISPR GAAGACTTACCATGGAAGAC TGG Intronic
900838680 1:5028700-5028722 GAAGAGTTACCAAGGAAGCCAGG - Intergenic
902675776 1:18007713-18007735 GAGGACTCTCCATGGAGGACAGG - Intergenic
905063764 1:35162154-35162176 GAAGAATCACCATGGATGAGTGG - Intergenic
906592409 1:47038754-47038776 GAAGATTTACCTTGGCAGAAAGG - Exonic
907721321 1:56974926-56974948 TAAGACTTACAATGGAGGGCTGG + Intergenic
909236059 1:73153692-73153714 GGAAACTTACCATGGCAGAAGGG + Intergenic
909965984 1:81911027-81911049 GAAGAGATAACATGGAAGAAAGG - Intronic
910204674 1:84737214-84737236 GAAATCTTACCAGGGAAGAAAGG + Intergenic
910507837 1:87970382-87970404 GAAGAGAGACCATAGAAGACGGG - Intergenic
910528258 1:88205920-88205942 CAAGACTTTCCATTGAAGACTGG - Intergenic
911827530 1:102506253-102506275 GAAGCATTACCTTGGAAAACTGG - Intergenic
912036178 1:105318577-105318599 GAAGACATACAATGGCAAACAGG - Intergenic
914407154 1:147387574-147387596 GAAGACTTTCCATCTAAGATTGG - Intergenic
915250990 1:154588358-154588380 TAAGGCCTACCATGGGAGACTGG + Intronic
918635569 1:186770388-186770410 GAAGAGTTAGCATGGAAAAATGG - Intergenic
920614755 1:207479268-207479290 GAAGACTTACCACAAAGGACAGG - Exonic
923656316 1:235920349-235920371 GCAGACTTACCCTGGAGGCCAGG + Intergenic
1066263355 10:33750711-33750733 GAAAACTCACAATGGAAGTCAGG - Intergenic
1066703362 10:38153037-38153059 CAAAACTTACCATGGACCACGGG + Intergenic
1068060755 10:52064621-52064643 GCAGCCTTGCCCTGGAAGACAGG + Intronic
1068836460 10:61559798-61559820 GATGACTATCCATGGGAGACTGG - Intergenic
1069770462 10:70895595-70895617 GCAGACTTAACATGGTAGATTGG - Intergenic
1070192991 10:74129897-74129919 TAAAACTTACCATGAAAGAAAGG + Exonic
1071364228 10:84882727-84882749 GAAGAGTTTGCATGGAATACAGG - Intergenic
1073995634 10:109312993-109313015 GAAGACTATGCATGGAATACAGG - Intergenic
1075724624 10:124604989-124605011 GAACACTGACCAAGGGAGACGGG - Intronic
1077871086 11:6261812-6261834 GAAGACATAAGATGGAAGGCAGG + Intronic
1078343910 11:10526169-10526191 CAAGACATAGGATGGAAGACTGG + Intronic
1078669592 11:13353144-13353166 TAAGACTTACAGTGGAAGAAAGG + Intronic
1082632763 11:55560730-55560752 GAAGACTCACTATTGAAGACAGG - Intergenic
1083161885 11:60859361-60859383 CAAGAGTTACCAGGGAAGACAGG - Intergenic
1084291603 11:68173490-68173512 GAAGACTGACTGTGGAAGCCAGG + Intronic
1086249622 11:84797841-84797863 AAAGACTTCCCAAGAAAGACAGG - Intronic
1087279331 11:96192572-96192594 CAAGACTTAAGATGGAAGACAGG - Intronic
1088005187 11:104931131-104931153 GAAGAATTACCACTGAAAACTGG + Intergenic
1088219622 11:107555423-107555445 GAATATTCACCATGGAGGACGGG + Intronic
1089237243 11:117040693-117040715 GAAGACTTACCATGGAAGACTGG + Intronic
1091056296 11:132422334-132422356 GAAAACAGACCATGGAAGAGTGG + Intronic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1092764837 12:11843153-11843175 GAAAACTTACCACAGAACACAGG + Intronic
1095788632 12:46139265-46139287 GAAGACATACAATGGCAAACAGG - Intergenic
1095856009 12:46861915-46861937 GAAGACTATGCATGGAATACAGG - Intergenic
1096495259 12:52036277-52036299 AAATTCTTACCATGGAAGCCTGG + Intronic
1098640828 12:72836707-72836729 GAAAGCTTACTATGGAAGTCAGG + Intergenic
1106318175 13:28613628-28613650 GAAGAGATTCCAGGGAAGACAGG - Intergenic
1107092612 13:36498439-36498461 AAAGACTTACCACAGATGACAGG + Intergenic
1107931437 13:45310963-45310985 GAACACTTACAATAAAAGACAGG - Intergenic
1110329762 13:74257906-74257928 GAAGACTTTTCAAGTAAGACAGG - Intergenic
1113522354 13:110949931-110949953 GAAAACTTACAATGGCAGAAGGG - Intergenic
1114758010 14:25282111-25282133 GAAGAGTATCCATGGAATACAGG - Intergenic
1126409475 15:48357189-48357211 GAAGAGTGACTCTGGAAGACTGG + Intergenic
1127457819 15:59171071-59171093 GAAGACTAAGAATGGAAGAAAGG - Intronic
1131599641 15:93833047-93833069 GAAAATTTAACATAGAAGACTGG + Intergenic
1132804570 16:1769567-1769589 GAAGACTCACCTTGGAGGAGTGG + Exonic
1134207186 16:12247937-12247959 GTAGAATTACCATGGAACAAGGG + Intronic
1137625414 16:49904787-49904809 GAAGACTTACTATGAAAAAAAGG - Intergenic
1146141420 17:30371292-30371314 GAAGATTTACCTTGGCTGACAGG - Intergenic
1150444060 17:65214816-65214838 GAAGATGTATCATGGAAGGCTGG + Intronic
1153138660 18:1946718-1946740 GGGGACTTCCCATGGAAGAGAGG - Intergenic
1153388311 18:4525708-4525730 GAAGACATACAATGGCAAACAGG - Intergenic
1154052903 18:10979349-10979371 GAAGCTTTGCCATGGAAGATTGG - Intronic
1155129135 18:22912648-22912670 GAAGACTTCACATGGGAGATGGG - Intronic
1157903523 18:51544015-51544037 GAAGACTGAAAATGGAAGAAAGG + Intergenic
1159037246 18:63289579-63289601 GAAGACTTACCTAGGAAAAGAGG + Intronic
1163455915 19:17405528-17405550 GCAGAGTGCCCATGGAAGACGGG - Exonic
1165335372 19:35166159-35166181 GATAACTTACCATAGAAGAAGGG - Exonic
1165486501 19:36099769-36099791 CAAGACTTCCCAAGGCAGACAGG + Intronic
927266266 2:21155142-21155164 GAAGAGTTAACTTGGGAGACAGG - Intergenic
927372629 2:22374503-22374525 GAAAACTAACCATGCAAGGCAGG - Intergenic
937802574 2:126097322-126097344 GAAGAGTAAGCATGGAATACAGG + Intergenic
938253722 2:129836546-129836568 GAAGACATACAATGGCAGACAGG + Intergenic
940077262 2:149756374-149756396 GAAGACCTACAATGAAAGAAAGG - Intergenic
940989011 2:160079030-160079052 GATGACTTACCAAAGAACACAGG - Intergenic
942166208 2:173243479-173243501 AAAGACTTACCTTGGAACAGGGG + Intronic
942364152 2:175205130-175205152 CAAGACTTAAGATGGAAGCCAGG - Intergenic
944557033 2:200897451-200897473 GAAGTCTGACCATTGTAGACTGG + Intronic
945179969 2:207081958-207081980 GAATACTTACCATGGAGGGTTGG - Intronic
945829275 2:214763643-214763665 GAACTCTTCCCATGGAAGAAGGG - Intronic
947247603 2:228066767-228066789 GAAAATTTATCATGGAAGAATGG - Intronic
947285156 2:228506097-228506119 GAAGCCATACTATGGAAGATGGG + Intergenic
1169022109 20:2337835-2337857 GTAGACTTGCCATGGAAATCTGG - Intronic
1170946585 20:20896359-20896381 GAAGTGTTACCATTGAAGGCTGG + Intergenic
1173718997 20:45236760-45236782 GACGACTGACTATAGAAGACAGG - Intergenic
1178428601 21:32499448-32499470 GGAGACTTTCCAGGGAAGCCCGG - Intronic
1180127498 21:45802330-45802352 GCATCCTGACCATGGAAGACAGG - Intronic
1180970221 22:19811374-19811396 GAGGACATACCATGGAATAGGGG - Intronic
954511253 3:51127921-51127943 GAAGAGTAAGCATGGAATACAGG - Intronic
954749789 3:52806962-52806984 AAAGACTTACTTTGGAAAACTGG + Exonic
955627297 3:60932026-60932048 AAAAACTTACCCTGGCAGACTGG - Intronic
955801568 3:62692278-62692300 GAAGAATTACCTTGGAAGTGGGG - Intronic
959241412 3:103800130-103800152 GAAGACTTACCACAAAAGAATGG - Intergenic
960690042 3:120337037-120337059 GAATTCTTACCATGGAAGTTTGG - Intronic
961667443 3:128502413-128502435 CAAGAATTACCAGGGAAGACTGG + Intergenic
963462912 3:145639851-145639873 GAAGAGTTCCCAGGGAAAACTGG + Intergenic
964994742 3:162864862-162864884 GTAAAATTACCATGGAAGAAGGG - Intergenic
968568514 4:1327434-1327456 GCAGACTTTCCAGGGAACACTGG - Intronic
969438489 4:7202344-7202366 GAGGACTCTCCTTGGAAGACTGG + Intronic
970328455 4:14953697-14953719 GAAGGCTTAGCATGAAAGCCAGG - Intergenic
970779371 4:19717780-19717802 GAAGGCTTACGATAGAACACTGG - Intergenic
972411029 4:38794998-38795020 GAAGAGTGACCAAGGAAGAATGG + Intronic
973193599 4:47414717-47414739 GGTGACTTACCATGGAGAACAGG - Intronic
974419071 4:61647833-61647855 GAAAACTTACAGTGGAAAACTGG - Intronic
974630198 4:64479290-64479312 AAAGCCTTCCCATGAAAGACAGG - Intergenic
974892119 4:67895641-67895663 GAAAAATAACCATGGAAGAATGG + Intergenic
974974758 4:68876830-68876852 CAAGACCTACCATGGAAGTTAGG - Intergenic
974982977 4:68984223-68984245 CAAGACCTACCATGGAAGCTAGG - Intergenic
975017559 4:69441905-69441927 CAAGACCTACCATGGAAGCTAGG + Intergenic
975714342 4:77191118-77191140 AAACACCTACTATGGAAGACTGG - Intronic
976396705 4:84563580-84563602 GAATTCTTAGCATGGAAAACAGG + Intergenic
977090634 4:92671175-92671197 CATGTCTTACCATGGCAGACAGG + Intronic
977711532 4:100132196-100132218 GAATACTAGCCAAGGAAGACAGG + Intergenic
978060725 4:104334454-104334476 GAAGACTTCCCCTTGAAAACTGG + Intergenic
978757433 4:112318519-112318541 TATGACCTAACATGGAAGACTGG + Intronic
980516994 4:133877070-133877092 GAAGCCTTTCCCTGGAAAACTGG - Intergenic
980996718 4:139786115-139786137 GAAGGGTGACCATGTAAGACTGG + Intronic
981619104 4:146673650-146673672 GAAGAGTTACCATAAAAGGCTGG + Intergenic
983330770 4:166325273-166325295 GCAGACTTGCCCTGGAAGAAAGG + Intergenic
983405988 4:167330828-167330850 GAACACTTACCACGGACAACTGG - Intergenic
984627668 4:182025800-182025822 GAAGACTTATAATGGCAAACAGG - Intergenic
990434963 5:55780616-55780638 GAAGGGTTACCATGCAGGACTGG + Intronic
991669004 5:69028460-69028482 GAACTCTAAACATGGAAGACAGG + Intergenic
992840309 5:80683483-80683505 GAAGACATACAATGGCAGCCTGG - Intronic
993206942 5:84894458-84894480 GAAGCCTTTCCAAGAAAGACAGG - Intergenic
994457408 5:100028587-100028609 AAAGCCTTCCCAAGGAAGACTGG + Intergenic
997237208 5:132279731-132279753 CAACACTCTCCATGGAAGACTGG - Intronic
998796562 5:145825988-145826010 GAACACTTACCTGGGAAGACAGG + Intronic
999849157 5:155518922-155518944 GAAGACTTACAATGACAAACAGG - Intergenic
1000061637 5:157662655-157662677 TAAAACTTACCCTGAAAGACTGG + Intronic
1007318884 6:41012016-41012038 GAAGATTTATCATTGAAGAAAGG + Intergenic
1008811904 6:55512574-55512596 GTAGACTTACTATGGAGGACAGG + Intronic
1010310777 6:74382990-74383012 GAAGAGTTAACATGGAACTCTGG - Intergenic
1010325859 6:74561154-74561176 GAAGACTATGCATGGAATACAGG + Intergenic
1016608486 6:145962160-145962182 GAAGCCTTTCCAGGGAAGATTGG - Intronic
1018530802 6:164761265-164761287 GAATACTTAACATGAAAGAATGG - Intergenic
1018720616 6:166569264-166569286 GAAAACCCGCCATGGAAGACGGG - Intronic
1019776239 7:2913511-2913533 GAAGACCTTCCACGGAGGACGGG + Intronic
1021751699 7:23807218-23807240 GTAGACTTACCTTGAAAGAATGG - Intronic
1022986239 7:35657225-35657247 GAAGACATACAATGGCAAACAGG + Intronic
1024097442 7:45994334-45994356 GAAGACTGAACATGGAATCCAGG + Intergenic
1024141163 7:46464728-46464750 GAAGTTATACAATGGAAGACTGG - Intergenic
1027967222 7:85027643-85027665 GAAGTAAAACCATGGAAGACAGG + Intronic
1031049171 7:116927770-116927792 GAAGACTCAGAATGGAAGAAAGG + Intergenic
1031227152 7:119054001-119054023 TAAAACTTAACATGAAAGACTGG - Intergenic
1031448384 7:121882968-121882990 GAAGATGTAGCATGGAACACAGG + Intronic
1034552006 7:151826992-151827014 GAAAATTTAACATGGAAGGCTGG + Intronic
1035147152 7:156830639-156830661 GAAGACTTAAGATGGAATGCTGG - Intronic
1035154682 7:156902679-156902701 GGATACTTAAAATGGAAGACAGG + Intergenic
1036094711 8:5711072-5711094 GGAGTCTGTCCATGGAAGACAGG + Intergenic
1037075718 8:14714847-14714869 GAAAACTTACCAGGGAATGCGGG + Intronic
1039558577 8:38495059-38495081 GAAGACTTCCCAGAGGAGACGGG + Intergenic
1040277738 8:46022537-46022559 GAAGGCTTTCCATGGAGGCCTGG - Intergenic
1048530216 8:135241221-135241243 GAAGATTTTCCATGGAAATCTGG + Intergenic
1049791928 8:144476102-144476124 GAAACCTGACCAGGGAAGACGGG - Exonic
1050421858 9:5473887-5473909 GAAGAATTCCCTTGGAAAACTGG - Intergenic
1050517236 9:6457583-6457605 GAAGAATTCCCTTGGAAAACTGG - Intronic
1055903698 9:81269425-81269447 GAAGACTATGCATGGAATACAGG - Intergenic
1056035482 9:82600611-82600633 GCAGGCTTATCCTGGAAGACCGG + Intergenic
1057974093 9:99585660-99585682 GAAAACTGAGGATGGAAGACTGG + Intergenic
1058402994 9:104638186-104638208 GAAGACTTTCCCTTGAAGATGGG - Intergenic
1058975359 9:110121223-110121245 GAATACTTACAATTTAAGACAGG - Intronic
1059736755 9:117108222-117108244 GAATACCTAGCATGGAATACTGG - Intronic
1186711490 X:12202554-12202576 GAAGACTGGCCATGGGAGAAAGG + Intronic
1189794601 X:44634563-44634585 GTACTCTTGCCATGGAAGACGGG - Intergenic
1190121537 X:47663875-47663897 GCAGACTTACCTTGAAAGAATGG - Intergenic
1193361163 X:80580806-80580828 TAAGACTTAGCATGGATGAATGG - Intergenic
1196135729 X:112207787-112207809 TAAGACTCACCATGGAATCCTGG + Intergenic
1198781321 X:140239078-140239100 GAAGACATACAATGGTAAACAGG - Intergenic
1199361123 X:146920240-146920262 GAAGACATACAATGGCAAACAGG - Intergenic
1199775754 X:151010049-151010071 AAGTACTAACCATGGAAGACTGG + Intergenic
1200754905 Y:6982012-6982034 GAAAACTTACCATTGAAAATGGG + Intronic
1201941674 Y:19466919-19466941 GAAGACTTCCCCTCTAAGACAGG + Intergenic