ID: 1089240216

View in Genome Browser
Species Human (GRCh38)
Location 11:117071559-117071581
Sequence AAGGATAAATAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1635
Summary {0: 1, 1: 1, 2: 14, 3: 140, 4: 1479}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089240213_1089240216 18 Left 1089240213 11:117071518-117071540 CCTAGAACACAGTGACACTCAAA 0: 1
1: 0
2: 4
3: 24
4: 318
Right 1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG 0: 1
1: 1
2: 14
3: 140
4: 1479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089240216 Original CRISPR AAGGATAAATAGAAGGAAGA AGG Intronic
900498748 1:2989373-2989395 GAGGATGAATAGATGGAGGATGG - Intergenic
900498790 1:2989569-2989591 ATGGACAAATGGATGGAAGATGG - Intergenic
901137169 1:7005459-7005481 AAGAAGAAAAAGAAGGCAGAAGG - Intronic
901194918 1:7435062-7435084 AAGAAAAAAAAGAAGGCAGAGGG + Intronic
901209595 1:7517241-7517263 AAGGATAATTAGAAGGATCCTGG - Intronic
901833736 1:11910067-11910089 AAAGATAGATTGAAGGAAAAAGG + Intergenic
902101302 1:13992034-13992056 AAGGATGAATAGAAGTTAGCTGG - Intergenic
902275085 1:15333805-15333827 AAAGATAAATAAAATAAAGATGG - Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902620419 1:17647529-17647551 AAGAATGAATAAAAGGAAGGAGG - Intronic
903352487 1:22726185-22726207 AAGGAGAAAAAGGAGGAAGGAGG - Intronic
903395276 1:22997195-22997217 AAGGAAAAATAGGAGGGAAAAGG - Intergenic
903395294 1:22997435-22997457 AAGAGAAAATAGGAGGAAGAAGG - Intergenic
903572217 1:24314383-24314405 AGGGATAGATAGAAGGGAGATGG - Intergenic
903584006 1:24394444-24394466 AAAAATTAATAGGAGGAAGAAGG + Intronic
903682875 1:25108785-25108807 AAGGAAAGATGGAAGGAAGGAGG + Intergenic
903939559 1:26920071-26920093 AAGGAAAAAAGGAAAGAAGAAGG + Intronic
903940515 1:26927151-26927173 AAGGATGAATAGCTGTAAGAAGG + Intronic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904334737 1:29789615-29789637 AAGGACAAGGAGAAGGGAGAGGG + Intergenic
904480691 1:30791541-30791563 AAGGACAAAGAGAGGGAAGGAGG + Intergenic
904522823 1:31109168-31109190 AGGAAGAAATAGAAGGAAGGAGG - Intergenic
904609275 1:31716038-31716060 AGGGATAACTGCAAGGAAGAAGG - Intergenic
905074890 1:35261733-35261755 AAGGAGAAAAAGGAGGAAGAAGG - Intergenic
905490681 1:38341182-38341204 AAAGAAAGAAAGAAGGAAGAAGG - Intergenic
905949739 1:41939473-41939495 AAGGAAAAATAAAAAGAAAAAGG - Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906242399 1:44249971-44249993 AAGGAAAAAGGGAAGGAAGGGGG + Intronic
906541000 1:46585980-46586002 AAGGAAAAAATGTAGGAAGATGG + Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
906801584 1:48742417-48742439 AAAGAAAAAAAAAAGGAAGAAGG + Intronic
907072704 1:51551368-51551390 ACGGATGAAGAAAAGGAAGATGG - Intergenic
907760607 1:57355166-57355188 AGGAAAAAAGAGAAGGAAGAGGG - Intronic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
908121950 1:60994234-60994256 AGAGATCAAGAGAAGGAAGAGGG - Intronic
908371138 1:63478931-63478953 AAGGACAAATGGAAGGGAGGTGG + Intronic
908421305 1:63961083-63961105 AAGGATGAATGGAGGGAAGAAGG - Intronic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908693109 1:66804837-66804859 AAGGATGAAAGGAAAGAAGAAGG - Intergenic
909041483 1:70658093-70658115 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
909165660 1:72221180-72221202 GAGGATACATAGAGGAAAGAAGG - Intronic
909251630 1:73364353-73364375 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
909339141 1:74511996-74512018 AAGGAAAATCGGAAGGAAGAGGG + Intronic
909551601 1:76904178-76904200 AAGGATGAATAGATGCCAGATGG + Intronic
909605674 1:77505912-77505934 AAGGAAAAATAGAAAGGAGGAGG + Intronic
909611598 1:77556970-77556992 AAGGAAAAAAAAAAGGTAGAGGG - Intronic
909656287 1:78037017-78037039 AAGGAAAAGTAGAACGCAGAAGG + Intronic
909766073 1:79357569-79357591 AAGGTTAATTTCAAGGAAGATGG - Intergenic
909782975 1:79570865-79570887 AAAGATAAGTAGAATGAAAAAGG - Intergenic
909831151 1:80191623-80191645 AGAGATACATATAAGGAAGAAGG + Intergenic
909891245 1:81009859-81009881 AGGAATTTATAGAAGGAAGATGG + Intergenic
909964031 1:81885127-81885149 ACGAATAAATAGAAGTAAGGAGG + Intronic
909996682 1:82288998-82289020 TAGGAAACATAGTAGGAAGAAGG + Intergenic
910171330 1:84380477-84380499 AAGAAAGAAAAGAAGGAAGAAGG + Intronic
910324108 1:85984677-85984699 AAGCAGAAATAGAAGTATGAAGG - Intronic
910678677 1:89841120-89841142 AAGGATTGAGAGAAGGAAAAAGG + Intronic
910985907 1:93004284-93004306 AAAGAGAAATAGGAGGAAGATGG - Intergenic
911035060 1:93533831-93533853 AAGGGTAATTAGAGAGAAGAGGG - Intronic
911190648 1:94945177-94945199 AAAGATAAAAATAGGGAAGAAGG - Intergenic
911360177 1:96866063-96866085 AAACATATACAGAAGGAAGATGG - Intergenic
911388058 1:97202729-97202751 AAGGACAGATACAAGGAAGGGGG - Intronic
911462280 1:98205971-98205993 AAGGAAAAAAGGAAGGAAGAAGG + Intergenic
911624893 1:100112361-100112383 TACAATAAATAGAAGGAAGATGG + Intronic
911737503 1:101353871-101353893 AAGGAGAGATAGAGAGAAGAAGG - Intergenic
912165397 1:107037330-107037352 AATGATAAATAGGAGTAGGAAGG - Intergenic
912219343 1:107654610-107654632 AAGGATAAAGTGAGGGAAAAAGG - Intronic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912349163 1:108995373-108995395 AAAGAAAAATAGAAGGAAAATGG + Intronic
912571512 1:110627661-110627683 AAGGAAAACAAAAAGGAAGAAGG + Intronic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
912805471 1:112753253-112753275 AAGGAAAGAAAGGAGGAAGAAGG - Intergenic
912862659 1:113228316-113228338 AAGAATAAATGGAATCAAGAAGG + Intergenic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914313692 1:146489012-146489034 AATAATAAACAGAAGGAAAAGGG + Intergenic
914500657 1:148244369-148244391 AATAATAAACAGAAGGAAAAGGG - Intergenic
914991557 1:152503324-152503346 AAGGATAGATGGAAGGGAAAAGG - Intergenic
915660087 1:157398073-157398095 AAGAATAAATAAAAGGGAGGGGG - Intergenic
916015796 1:160748919-160748941 ATTGATAAATAGATGCAAGAAGG + Intronic
916146720 1:161746549-161746571 AAGGAAGGATGGAAGGAAGACGG - Intergenic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916199295 1:162254937-162254959 AAGGAATAATAGAAAGAATATGG - Intronic
916202983 1:162289289-162289311 AAAGAAAGAAAGAAGGAAGAAGG - Intronic
916422603 1:164650876-164650898 AAGGAGGAAAAGAAGGGAGAAGG - Intronic
916610666 1:166388369-166388391 AAAAAAAAAAAGAAGGAAGAAGG + Intergenic
916952227 1:169792315-169792337 AAGGTCAAATAGAATGAAGATGG + Intronic
917499194 1:175570620-175570642 AAGGAAAAAAGGAAAGAAGAAGG - Intronic
917631225 1:176893355-176893377 AAGGATAAAGGAAAGGCAGAGGG - Intronic
917839401 1:178965211-178965233 AAGGAAGGAGAGAAGGAAGAAGG - Intergenic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918356617 1:183710872-183710894 GTGGATAACTAGAAGGAAAAGGG + Intronic
918415560 1:184303030-184303052 AAAGAGAAATAGAAGCCAGAAGG - Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918665611 1:187146816-187146838 AAGGAAAGATGGAAGGAAGGAGG - Intergenic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
918730152 1:187983021-187983043 AAGGAGAACAAGAAGGATGAAGG + Intergenic
918794845 1:188880547-188880569 GAGGAAAAAAGGAAGGAAGAAGG - Intergenic
918846387 1:189620235-189620257 AAGGAGAAAGAGAAGAAAGGTGG + Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919393756 1:197019760-197019782 AAGGAAAAAAGCAAGGAAGAGGG + Intergenic
919424915 1:197417837-197417859 AAGGATAGAAAGAGGGAAGAAGG + Intronic
919586021 1:199441396-199441418 AAGGAGTAAAAAAAGGAAGAAGG + Intergenic
919651487 1:200153765-200153787 AAGAAAAAATAAAAGGAAGGAGG + Intronic
919845909 1:201642052-201642074 AAGGAAAAAAAGAAAGAAAAGGG - Intronic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920235182 1:204498260-204498282 AAGGAGAAATATAAGGCAGTGGG + Intergenic
920369926 1:205472515-205472537 AAGGAAAGAAGGAAGGAAGAAGG + Intergenic
920403062 1:205689207-205689229 AGGGATAAATCCAAGGAAGCAGG + Intergenic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920654711 1:207867081-207867103 AAGGGTAACTAGAAGGATGGTGG - Intergenic
920811067 1:209286083-209286105 AAGGATAGAAGGAAGGAAGGAGG + Intergenic
920917568 1:210270352-210270374 AGGGATAGATAGAAGGAAGGAGG - Intergenic
921132023 1:212227985-212228007 AAGGAGAATGCGAAGGAAGAAGG - Intergenic
921382437 1:214538201-214538223 AAGAATGAATGGAAGGAGGAAGG + Intronic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921481369 1:215667712-215667734 AAGGAAAAAAACAAAGAAGAAGG + Intronic
922129354 1:222761620-222761642 AAGGAGAAAAGGAAGGAAGGAGG - Intergenic
922373167 1:224931572-224931594 AAGGATGAATGGCAGGAAGTGGG - Intronic
922865706 1:228859861-228859883 AAGGAAAAATAAAAGGAGGGAGG + Intergenic
923026332 1:230207367-230207389 AAGGATAGATACAAGGAATAAGG + Intronic
923247574 1:232147458-232147480 AAGGAGGAAGTGAAGGAAGAAGG + Intergenic
923261003 1:232268054-232268076 AAGGAAGGATAGAAGGAAGGAGG - Intergenic
924038515 1:239960019-239960041 AAGGAAAAAATGAAGGAAGGAGG - Intergenic
924142678 1:241042093-241042115 AAGAATAACTCTAAGGAAGAAGG + Intronic
924952193 1:248895372-248895394 AAGGACAAAGAGGAGGAAGAAGG + Intergenic
1063246475 10:4225038-4225060 AAGAGAAAATAAAAGGAAGAGGG + Intergenic
1063656368 10:7994095-7994117 AAAGAGAAAGAGAAAGAAGAAGG - Intronic
1063993009 10:11586759-11586781 AAGTATAAATAGAGGCAAGAGGG + Intronic
1064420790 10:15189097-15189119 AAGAATAAATAAAAGAATGACGG - Intergenic
1064510584 10:16086136-16086158 AAGACTAAATAGAATCAAGACGG + Intergenic
1064624270 10:17246411-17246433 AAGGATAAATGGGAAGAAGTAGG + Intergenic
1064686343 10:17866286-17866308 AAGGAAAAAGGGAAGGAAGGAGG + Intronic
1064886338 10:20116547-20116569 AAGGTTTAATAGAAGTAAAAAGG + Intronic
1064968624 10:21040490-21040512 AAGGAGAAATAGAGGAGAGAAGG + Intronic
1065002485 10:21349648-21349670 AAAGAAAAATATAAGGAAAAGGG - Intergenic
1065360031 10:24880950-24880972 AAGGAAAGAAAGAAAGAAGAAGG - Intronic
1065761582 10:28987805-28987827 AAGGAGAAGTAGGAAGAAGAAGG - Intergenic
1065992397 10:31025180-31025202 AAGGAGGAACAGAAGGAAGGAGG + Intronic
1066124561 10:32328017-32328039 AAGCAGGAATAAAAGGAAGAGGG + Intronic
1066401205 10:35077938-35077960 AAGGATGAATAAAAGGGACATGG + Intronic
1066533181 10:36362708-36362730 AAGGAAAAATAAAAGGGTGACGG - Intergenic
1066553417 10:36584579-36584601 AAGGATGAAAAGTAGGAAGGAGG - Intergenic
1066596380 10:37054753-37054775 AAAGAGAAAAAGAAGAAAGAAGG + Intergenic
1067051489 10:43024059-43024081 ATGGATAAATGGATGGATGATGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067443430 10:46326202-46326224 ATGGATAAAAGGAAGGAACAGGG + Intronic
1068087123 10:52388226-52388248 AAGGAAAAATAAAGAGAAGAAGG + Intergenic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1068330525 10:55560224-55560246 AAGGAAAAAATGCAGGAAGATGG + Intronic
1068490333 10:57715322-57715344 AAGGATAATTATAAGAAAAAAGG - Intergenic
1068594080 10:58883608-58883630 AAGAAGAAAGAGAAGGGAGAAGG + Intergenic
1069055862 10:63844088-63844110 AAGGATAAGGAGAAGGAAATAGG - Intergenic
1069500910 10:68952277-68952299 AAGGAAAAAAAAAAGGAATATGG - Intergenic
1069770561 10:70896630-70896652 AAGAAAAAAGAAAAGGAAGAGGG - Intergenic
1069971406 10:72173254-72173276 AAGAATAAAGAGAAAGAAAAAGG - Intronic
1070086571 10:73243720-73243742 AAGGACAAATAGAAGGTATGCGG + Exonic
1070267920 10:74922413-74922435 AAGGAAAAAAAGAAGAAAGATGG + Intronic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1070514888 10:77195581-77195603 AATGTTAATTAGAAGCAAGAAGG - Intronic
1070754639 10:78984446-78984468 AAGGAAAGATAGAGGGAACATGG + Intergenic
1070987008 10:80697787-80697809 AAGGATAAAAAGAGGAAGGAAGG - Intergenic
1071106333 10:82100364-82100386 AAGGCTGAAAAAAAGGAAGAGGG - Intronic
1071223017 10:83491985-83492007 AGAGATACACAGAAGGAAGATGG + Intergenic
1071441652 10:85703510-85703532 AAGATTAAGTAGGAGGAAGAAGG + Intronic
1071468456 10:85961733-85961755 AAGGAAAGATAGAAGGAGGATGG - Intronic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1071973838 10:90935251-90935273 ATGGATAGATAGAAGATAGATGG + Intergenic
1072054962 10:91745729-91745751 AAAGAGAAGGAGAAGGAAGAAGG + Intergenic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072624939 10:97105147-97105169 AATTATAAATAGAAAGAAGGGGG + Intronic
1073833554 10:107414934-107414956 AAGAAGAAAGAGAAGGAAGTTGG + Intergenic
1074096359 10:110316878-110316900 AATGAAAAGTAGAAGAAAGAAGG + Intergenic
1074577576 10:114684829-114684851 AAGGAAAAAGAGGAGGCAGAAGG - Intronic
1074707878 10:116151597-116151619 ATGGGAAAATAGAGGGAAGAGGG + Intronic
1074724081 10:116289688-116289710 AGGGAGAAAAAGAAGGAAGGAGG - Intergenic
1074813929 10:117130893-117130915 AAGGAGAAAGAGCAGGAAGCTGG + Intronic
1074917868 10:117975023-117975045 AAGTAAAAATAGAAGGAGAAGGG + Intergenic
1074922554 10:118031545-118031567 AAGGAAGGAAAGAAGGAAGAGGG + Intronic
1075963027 10:126585579-126585601 AAGGAAAAATAAAGGAAAGAAGG + Intronic
1076068176 10:127465121-127465143 AAGAAGAGAAAGAAGGAAGAAGG + Intergenic
1076148638 10:128145382-128145404 AAGGAAGAATGGAAGAAAGAAGG + Intergenic
1076348002 10:129793854-129793876 AAGGAAAAGAGGAAGGAAGAGGG - Intergenic
1076558702 10:131346980-131347002 AAGGAAGGAGAGAAGGAAGAAGG - Intergenic
1076558714 10:131347027-131347049 AAGGAAGGAGAGAAGGAAGAAGG - Intergenic
1077280595 11:1743377-1743399 ATGGATGAATGGATGGAAGATGG + Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077820448 11:5733095-5733117 AAGAATAAATATAAGTAAGTTGG - Intronic
1077841165 11:5976196-5976218 AAGAATAAAAAGAGGGAAGGAGG + Intergenic
1077931849 11:6741056-6741078 AAGGATAAAGAAATGGAAAAAGG + Intergenic
1077947774 11:6921117-6921139 AAGGATAAATAGCAGGATCTGGG - Exonic
1077978235 11:7272443-7272465 GAGGATAAAATGAAGTAAGAGGG - Intronic
1078129068 11:8596950-8596972 AAGAATTAATAGAAGAAAGGAGG + Intergenic
1078293492 11:10040780-10040802 AGGGATAAAGAGAGGAAAGAAGG + Intronic
1078349018 11:10577264-10577286 AAGGAAGAAGAGGAGGAAGAGGG - Intronic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1079461407 11:20681932-20681954 AAGGGAAAATGGAAGGCAGAAGG - Intronic
1079572339 11:21959408-21959430 AAGGATAGAAAGAATGAACAAGG + Intergenic
1079593955 11:22218064-22218086 AAGGAAAAAAAGAAGAAAAATGG - Intronic
1079602893 11:22331433-22331455 ATGGATAAATGAATGGAAGAAGG - Intergenic
1079938104 11:26642880-26642902 AAGAAGAAATAGAGGGAAGATGG - Intronic
1080016943 11:27517696-27517718 AAGGAAAGAAGGAAGGAAGAAGG - Intergenic
1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG + Intergenic
1080438566 11:32268996-32269018 AAGGAAGAAAGGAAGGAAGAAGG + Intergenic
1080914921 11:36647629-36647651 AGGGATAAAGAGAAAGAAAATGG - Intronic
1081055282 11:38402476-38402498 AAGGAAAGAAGGAAGGAAGAAGG - Intergenic
1081095262 11:38924939-38924961 AGGGAGCAAGAGAAGGAAGAAGG - Intergenic
1081095270 11:38924971-38924993 AGGGAGATAGAGAAGGAAGAAGG - Intergenic
1081215356 11:40389883-40389905 TAGGATAAGTAGAAAGAAGTAGG + Intronic
1081215822 11:40396331-40396353 AATGATAAAAAGAATGGAGATGG - Intronic
1081232608 11:40604769-40604791 ATGGATAAAATAAAGGAAGAAGG + Intronic
1082044908 11:47717436-47717458 AAGGCTGAAGAGAAGGAAAATGG - Exonic
1082143662 11:48640926-48640948 AAGGAAAGAAAGAAGAAAGAAGG - Intergenic
1082182246 11:49133707-49133729 TAGGAAAACAAGAAGGAAGATGG - Intergenic
1082305216 11:50564129-50564151 TAGGATAAAAAATAGGAAGAAGG - Intergenic
1082564982 11:54666003-54666025 AAGGAAAGAAGGAAGGAAGATGG - Intergenic
1082745451 11:56956237-56956259 AAGAATAAAAGGGAGGAAGAAGG + Intergenic
1082763619 11:57149355-57149377 AAGGAGGAAAGGAAGGAAGAGGG + Intergenic
1083544328 11:63537784-63537806 AAGGAAATAGACAAGGAAGAGGG - Intronic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084486579 11:69451682-69451704 AAGGAAGAAAAGAGGGAAGATGG + Intergenic
1084543837 11:69803818-69803840 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543875 11:69804053-69804075 ATGGATGAAAAGATGGAAGATGG + Intergenic
1085099206 11:73786273-73786295 AAAGGGAAAAAGAAGGAAGAAGG - Intergenic
1085158343 11:74317520-74317542 AAAGAGAAAGAGAAGGAAGGAGG - Intergenic
1085163029 11:74366598-74366620 AAGGATAAAAATAAGCAAGTTGG + Intronic
1085308026 11:75499374-75499396 AAGGAAAAGAAGAAGAAAGAAGG - Intronic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085750850 11:79160038-79160060 AAGGATAGAAAGAATGAAAATGG - Intronic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086170586 11:83831924-83831946 AAGGGAAATTAGAAGGAAGGGGG + Intronic
1086220255 11:84434400-84434422 AATGATGAGTGGAAGGAAGAAGG + Intronic
1086221619 11:84452113-84452135 AAAAAAAAAAAGAAGGAAGAAGG + Intronic
1086285680 11:85247487-85247509 AAGGAAAAAATGAGGGAAGAAGG - Intronic
1086683262 11:89701239-89701261 TAGGAAAACAAGAAGGAAGATGG + Intergenic
1086841423 11:91689631-91689653 AAGGGACAAAAGAAGGAAGAGGG - Intergenic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087163816 11:94977636-94977658 AAAGATAAAAAGAAGAAAGAGGG - Intronic
1087407096 11:97744186-97744208 AAGGATATTTAGAAGGAAAAAGG + Intergenic
1087504909 11:99007345-99007367 CAGCCTTAATAGAAGGAAGATGG - Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087982730 11:104636301-104636323 ATGCAAAACTAGAAGGAAGAAGG - Intergenic
1088031162 11:105252503-105252525 AATGTTAAATAAAAGGAGGATGG - Intergenic
1088067663 11:105740804-105740826 AAGTTTAAATAGAAGAAAAAGGG + Intronic
1088168842 11:106971566-106971588 AAGGATATAGACAAGCAAGAGGG + Intronic
1088696038 11:112366641-112366663 AAGGAAGAAAAGAAGGAAGAAGG - Intergenic
1088751882 11:112849191-112849213 AAGGACAAGAGGAAGGAAGAAGG - Intergenic
1088753577 11:112866323-112866345 TAGGAGAAGTGGAAGGAAGAGGG - Intergenic
1088809667 11:113382808-113382830 AACGAGAAATAGAAGGGGGAAGG + Intronic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089718657 11:120390315-120390337 AAGCAAAAATAGAAGGCAGGAGG - Intronic
1089907623 11:122058784-122058806 AAGGATCAAAAGAATCAAGATGG + Intergenic
1089943038 11:122439607-122439629 ACAGATAAATACAGGGAAGAAGG - Intergenic
1090083800 11:123633364-123633386 AAGTCTTAATAGAAGGAAGCAGG - Exonic
1090321299 11:125845631-125845653 ATGGATAAATTGATGGAAGTAGG + Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090469893 11:126971018-126971040 AACAATAAATAAAAGGAAAATGG - Intronic
1090541866 11:127715526-127715548 AAAAATAAAGAGCAGGAAGAAGG - Intergenic
1090875326 11:130783945-130783967 AAGGATAAATTAAAGGAACTTGG - Intergenic
1091046285 11:132328723-132328745 AAAGATAACTGGAAGGAGGAAGG - Intronic
1091101100 11:132874429-132874451 AAGGAAAGAAGGAAGGAAGAAGG - Intronic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091324285 11:134672935-134672957 AAGGATAAATATAGGTAACAGGG + Intergenic
1091335136 11:134760973-134760995 AAGGATGGAAAGAAGGAAGGAGG - Intergenic
1091505027 12:1059053-1059075 AAGAATAAATTGAACCAAGAAGG - Intronic
1091858831 12:3760495-3760517 AAGCAAGAAGAGAAGGAAGAAGG + Intronic
1091949015 12:4576160-4576182 AAGGATGAATAGATGGACAATGG - Intronic
1091992527 12:4967476-4967498 GAGGATGAGTAGAAGGAAGAGGG - Intergenic
1092016859 12:5166658-5166680 AAGGAAAGAAGGAAGGAAGACGG - Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092211871 12:6651530-6651552 AAAAAAGAATAGAAGGAAGATGG - Intronic
1092228527 12:6764443-6764465 CAGGAAAAATAGGAGGAAGGTGG + Intronic
1092288187 12:7142091-7142113 AAGAACAAAGAGAAGGAAAAGGG + Exonic
1092560408 12:9607239-9607261 AAAGAAAAAGAGAAGGAGGAAGG - Intronic
1092588939 12:9932592-9932614 AAGGAAAAAAAGAAAGATGATGG - Intergenic
1092767219 12:11863516-11863538 AGGGAAATATACAAGGAAGAGGG - Intronic
1092811300 12:12273686-12273708 AAAGAAAAATAGAGGCAAGAAGG - Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093625894 12:21347701-21347723 AAGGAAAAAAGGAAGGAAGAGGG + Intronic
1093751605 12:22806461-22806483 AAAGATACAAAGAAGGAAAATGG + Intergenic
1093915658 12:24799812-24799834 AAGGAAAAAAAGAAAGAAAAAGG - Intergenic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094285301 12:28786029-28786051 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1094529062 12:31255747-31255769 AAGAATAAATGGAAGAAAGAGGG - Intergenic
1094671913 12:32578915-32578937 AAGGAGGAATAGGAGAAAGAAGG - Intronic
1095212866 12:39513589-39513611 AAAGAAAGAGAGAAGGAAGAAGG + Intergenic
1095463866 12:42470226-42470248 GAGGTAAAATAGCAGGAAGAAGG - Exonic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1095758216 12:45795414-45795436 AAAGAAAAAGAAAAGGAAGACGG - Intronic
1095861902 12:46926524-46926546 AAGTTTAAAAAGAAGGAAAAAGG + Intergenic
1095883891 12:47168460-47168482 AAGGATAAATAGACCTAAAAAGG - Intronic
1096251801 12:50038239-50038261 AAGAACAAATACAAGGATGAGGG - Intergenic
1096360503 12:50981806-50981828 AAGGAAAAAAAGATGGAAGAGGG + Intronic
1096362128 12:50997070-50997092 AAATATAAAAATAAGGAAGAAGG - Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096611227 12:52803312-52803334 ATGGATGAATAGATGGATGATGG + Intergenic
1096638050 12:52973829-52973851 AAGGAAGGAAAGAAGGAAGAAGG + Intergenic
1096910730 12:54981277-54981299 AAGGAAAGAAGGAAGGAAGAAGG + Intronic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097516176 12:60609425-60609447 CAGGGTAAATAGAAAGGAGATGG - Intergenic
1097718795 12:62998375-62998397 AAGGAAAAAAAGAAGAAACAAGG + Intergenic
1097958094 12:65506685-65506707 AGGGAGAACTAGGAGGAAGATGG + Intergenic
1098019714 12:66140908-66140930 AGGAATAAATATAAGAAAGATGG + Intronic
1098139303 12:67435453-67435475 AATGATGAAAAGAAGGAAGGAGG - Intergenic
1098251353 12:68572931-68572953 AAGGATGGATAGCAGAAAGAAGG + Intergenic
1098728624 12:74002455-74002477 AAGGATAAATATAATTAATAAGG + Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099134099 12:78872607-78872629 AATGAAGAAAAGAAGGAAGAAGG - Intronic
1099227541 12:79987711-79987733 AAGGAAAGAAAGAAGGAAGGAGG + Intergenic
1099493076 12:83309587-83309609 AAGAAGAGAAAGAAGGAAGAAGG + Intergenic
1099541195 12:83910078-83910100 AAACCTAAATGGAAGGAAGAGGG - Intergenic
1099568475 12:84282681-84282703 AAGGATAAATTGACAAAAGATGG - Intergenic
1099644898 12:85340537-85340559 GATGATAAATATAAAGAAGATGG - Intergenic
1099676276 12:85764779-85764801 AAGGAAGAATAAAAGGAAGGAGG + Intergenic
1099676277 12:85764783-85764805 AAGAATAAAAGGAAGGAGGAAGG + Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100089375 12:90952128-90952150 AAGGATGAATAGAAGAAAGGGGG - Intronic
1100100963 12:91105193-91105215 GAGGAAAAATGGAAAGAAGATGG + Intronic
1100337794 12:93648451-93648473 AAAGATAAAGGGAAGAAAGATGG - Intergenic
1100430115 12:94524323-94524345 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
1100778904 12:98002875-98002897 AAGGAGAGAAGGAAGGAAGAAGG + Intergenic
1101728931 12:107410683-107410705 AAGGAGAAAGAGAAGGGACAAGG + Intronic
1101827491 12:108231906-108231928 AAGGAAAGAGGGAAGGAAGAAGG + Intronic
1102188466 12:110967625-110967647 AAGATTAAATAAAAGGATGATGG + Intergenic
1102320379 12:111928383-111928405 ACAGATATATACAAGGAAGATGG + Intergenic
1102408767 12:112698837-112698859 AAGGAGAAGGAGAAGGAAAAGGG - Intronic
1102552503 12:113702082-113702104 AAGGAGAAAGGGAGGGAAGAAGG - Intergenic
1102624054 12:114220409-114220431 AAGGAAAGAGAGTAGGAAGATGG - Intergenic
1102705717 12:114878524-114878546 AAGGAAGAAAGGAAGGAAGAAGG - Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1102906992 12:116684297-116684319 AAGAAAAAAAAGAATGAAGAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103038991 12:117679134-117679156 AAGGATACATGGAGAGAAGACGG - Intronic
1103040336 12:117689984-117690006 AAGAAGAAAAGGAAGGAAGATGG + Intronic
1103269629 12:119662390-119662412 AAAGTTAAATAGATGAAAGAAGG - Intergenic
1103517514 12:121517056-121517078 AAAGATAAATATAAGAGAGATGG + Intronic
1103941465 12:124503557-124503579 ATGGATGGATAGATGGAAGACGG + Intronic
1104034722 12:125090357-125090379 ATGGATGAATAGATGGATGACGG - Intronic
1104096596 12:125563784-125563806 AAGGAGAAATACAGAGAAGAAGG + Intronic
1104508282 12:129353130-129353152 CAGGATAAAAAGAAGAGAGAAGG - Intronic
1104531379 12:129574192-129574214 ATGGATTAATAGATGCAAGAAGG + Intronic
1104539476 12:129649273-129649295 AAGGAGAAAGTGAAGGAATATGG - Intronic
1104813936 12:131635130-131635152 ATGGATGGATGGAAGGAAGAAGG - Intergenic
1104813964 12:131635300-131635322 ATGGATGGATGGAAGGAAGAAGG - Intergenic
1105597694 13:21854886-21854908 AAGGAGGAAGAGAAGGAAGAAGG - Intergenic
1105707591 13:22977694-22977716 AAGGAAAGAGAGAAAGAAGAAGG + Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106193580 13:27474979-27475001 AGGGACACAGAGAAGGAAGAGGG + Intergenic
1106273414 13:28177488-28177510 AAGGATAAAAAGGAGGGTGAGGG - Intronic
1106653985 13:31722570-31722592 AAGGAGAAAGAGGAGAAAGAAGG + Intergenic
1106826125 13:33522525-33522547 AAGGATAAATAGGCAGAACATGG - Intergenic
1106828953 13:33557199-33557221 AAGGAGGGAGAGAAGGAAGAGGG - Intergenic
1107037458 13:35916434-35916456 AAGGCTAATTGTAAGGAAGATGG - Intronic
1107216847 13:37931669-37931691 AAAGAGAAAGAGAATGAAGAGGG - Intergenic
1107315471 13:39126972-39126994 CAGGATATATAGAAGCCAGATGG + Intergenic
1108011932 13:46024315-46024337 AAGGATATACATCAGGAAGATGG - Intronic
1108025565 13:46173432-46173454 AAGGAAAGAAAGAAGGAAAAGGG + Intronic
1108147526 13:47495274-47495296 AAGGATGAAGGGAGGGAAGAAGG + Intergenic
1108281171 13:48863726-48863748 AAGGACAAGTACAGGGAAGAAGG - Intergenic
1108346000 13:49547737-49547759 AAAGATAGAAAGAAAGAAGATGG + Intronic
1108775350 13:53759099-53759121 AAGAATGAAAAGAGGGAAGAAGG - Intergenic
1108895527 13:55322630-55322652 AAGAAAAAATAGAAGGAAGGAGG - Intergenic
1109042672 13:57359564-57359586 AAGGATAAATAGTTGGAGCATGG + Intergenic
1109230026 13:59745208-59745230 AAGGCAAAAGAGAAGGGAGATGG + Intronic
1109299376 13:60575117-60575139 ACAAATAAATAGAAGAAAGAAGG + Intergenic
1109917512 13:69010989-69011011 AAGGATAGAAAGAAGGCAGAGGG - Intergenic
1110552872 13:76827947-76827969 AAGGAAGAAAGGAAGGAAGAAGG + Intergenic
1110582494 13:77147552-77147574 AAGGGTAGAGAGAAGGAAGGGGG - Intronic
1110865991 13:80397102-80397124 AAGGAGAACAAGAAGAAAGAAGG + Intergenic
1111146961 13:84194766-84194788 AAAGACAGAAAGAAGGAAGAAGG - Intergenic
1111506152 13:89191600-89191622 AAGGAGAAATAAAGAGAAGATGG + Intergenic
1111622924 13:90747356-90747378 AAGGATAAAAGGAGGGAACAGGG - Intergenic
1111988255 13:95087662-95087684 CAGGATGAATAGAAGCAAAAGGG + Intronic
1112069405 13:95831838-95831860 AAGGAAAGAAAGCAGGAAGAAGG - Intronic
1112119644 13:96395853-96395875 AAGGAGGAAAGGAAGGAAGAAGG + Intronic
1112167615 13:96936447-96936469 AAGTACAAATAAAAGGAAAAAGG - Intergenic
1112446772 13:99471644-99471666 TAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1112490511 13:99859090-99859112 AAGGAGGAGTAGCAGGAAGAAGG + Intronic
1112630895 13:101160299-101160321 AAAGCGAAAAAGAAGGAAGAGGG - Intronic
1112690461 13:101887633-101887655 ACAGTTAAATAGAAGGAATAAGG + Intronic
1112779826 13:102887669-102887691 AAGAATGAATAGCAGGAAAATGG + Intergenic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1113224832 13:108147894-108147916 ATGGCTGAATAGATGGAAGATGG - Intergenic
1113574467 13:111384143-111384165 AAGGACAAATGGAAAGGAGAGGG - Intergenic
1113673949 13:112195707-112195729 AAGGAAAGAAGGAAGGAAGAAGG - Intergenic
1114161118 14:20168792-20168814 GAGGATAAAGAGGAGGGAGATGG + Intergenic
1114647590 14:24264180-24264202 AAGGAAGGAAAGAAGGAAGAAGG - Intronic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115170207 14:30496368-30496390 AAGCATATATAGATGGATGATGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115422487 14:33212598-33212620 AAGGATAGATACTAGGGAGATGG - Intronic
1115985378 14:39099848-39099870 AAGGCTAAATAGAAGACAGGTGG - Intronic
1116020987 14:39460707-39460729 AAGGATACAAAGAAGGTATATGG - Intergenic
1116102087 14:40451541-40451563 AAGGAAGAAAATAAGGAAGAAGG + Intergenic
1116475081 14:45330866-45330888 AAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1116649157 14:47566898-47566920 AAGAAAAAAAAAAAGGAAGATGG - Intronic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1116743659 14:48790524-48790546 AAGGATGAAAGGAGGGAAGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117664192 14:58039265-58039287 AAGGATAAAGAGAAGGGAATAGG - Intronic
1117944347 14:61001758-61001780 AATGAATATTAGAAGGAAGAAGG - Intronic
1118553253 14:66981068-66981090 AAGGATAAAAATATGGCAGAGGG + Intronic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1118931205 14:70242720-70242742 AAGAATAAATATCATGAAGATGG - Intergenic
1119010355 14:70979565-70979587 AAGCATAAATAAAGGGAATAGGG - Intronic
1119110533 14:71969614-71969636 AAGGAGGAAAAGAATGAAGAAGG - Intronic
1119118193 14:72046637-72046659 GAGGAAGAGTAGAAGGAAGAAGG - Intronic
1119219214 14:72893021-72893043 AAGGATGAAAAGGAGGAGGAAGG + Intronic
1120033501 14:79669229-79669251 AAGTATAAATACAATCAAGAAGG + Intronic
1120077756 14:80179455-80179477 AAAAATAAAGAAAAGGAAGAGGG + Intergenic
1120100337 14:80437588-80437610 AAAGACAGAAAGAAGGAAGAAGG + Intergenic
1120117611 14:80638155-80638177 AAATATGAAGAGAAGGAAGAAGG - Intronic
1120391058 14:83909320-83909342 AAGGAAAAATAGAAAAAAAAAGG + Intergenic
1120428071 14:84376174-84376196 AAGGAAGAAAAGAAGAAAGAAGG + Intergenic
1120440438 14:84530423-84530445 AAGAATAAATAGAAGCTAGCAGG + Intergenic
1120470540 14:84918273-84918295 GAGAAGAAAAAGAAGGAAGAAGG - Intergenic
1120576335 14:86185994-86186016 AAGGAAAGAAAGAAGGAAGGAGG - Intergenic
1120584232 14:86291205-86291227 AAAGAGAAAGAGAAGAAAGATGG - Intergenic
1120613232 14:86668603-86668625 AAGGAAAAGAAAAAGGAAGAGGG - Intergenic
1120901909 14:89582747-89582769 AAGGATTAAAAGGAGCAAGAGGG - Intronic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121250078 14:92492896-92492918 AAGGAAAGATAGAAGGATCAGGG + Intronic
1121466658 14:94119963-94119985 AAGGACAAAGAGAAGAAAAAAGG + Intergenic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121882590 14:97514332-97514354 AAGGAAAAAAGGAAGGAAGGAGG - Intergenic
1121907174 14:97757169-97757191 GAGCATAAATAAAAGGAAGAGGG - Intronic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122392510 14:101399883-101399905 AAGGAAGAAAAGAAGGAAGTAGG + Intergenic
1122566985 14:102666134-102666156 AAAGATAAAGAGAAGGAAGTGGG + Intronic
1122671729 14:103378015-103378037 AAGGATAGAGAGAAAGAATAAGG - Intergenic
1122927443 14:104912279-104912301 AAGGATATATTTCAGGAAGAAGG + Intergenic
1123058792 14:105585134-105585156 ATGGATGGATAGATGGAAGAAGG - Intergenic
1123083120 14:105705360-105705382 ATGGATGGATAGATGGAAGAAGG - Intergenic
1123826872 15:24091492-24091514 AAGGAGGAATAGATAGAAGAGGG + Intergenic
1123841479 15:24252356-24252378 AAGGAGGAATAGATAGAAGAAGG + Intergenic
1123856261 15:24415323-24415345 AAGGAGGAATAGATAGAAGAGGG + Intergenic
1124037831 15:26072632-26072654 ATGGATAAATAAAAAGATGATGG - Intergenic
1124186288 15:27532369-27532391 AAGGAAGAAGAGAAGAAAGAAGG - Intronic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124486695 15:30123749-30123771 AAGGAAAAATAAAAGGGAAAGGG - Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124541773 15:30592728-30592750 AAGGAAAAATAAAAGGGAAAGGG - Intergenic
1124756834 15:32414571-32414593 AAGGAAAAATAAAAGGGAAAGGG + Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124862496 15:33456193-33456215 AAGGATTGATATATGGAAGATGG - Intronic
1124956178 15:34362047-34362069 TAGAATAAATAAAAGGAAGTGGG - Intronic
1124963784 15:34418542-34418564 AAGGCTAAATTATAGGAAGAAGG + Intronic
1124980404 15:34564773-34564795 AAGGCTAAATTATAGGAAGAAGG + Intronic
1125076924 15:35630315-35630337 AAGTAAAAAAAGAAGGAGGATGG + Intergenic
1125093424 15:35822956-35822978 AAAGATAAAAAGAAGAAATAAGG - Intergenic
1125187942 15:36953827-36953849 AAGGAAAATTAAAAAGAAGAAGG - Intronic
1125411653 15:39412487-39412509 AAGGACAAAAAGAAATAAGATGG - Intergenic
1125419142 15:39486789-39486811 AAGACTAAGTAGAAGGAATACGG - Intergenic
1125547284 15:40515320-40515342 AAAGAAAAAGAGGAGGAAGAGGG - Intergenic
1125932251 15:43608792-43608814 AAGAATAAATAGGAATAAGAAGG - Intronic
1125945348 15:43708264-43708286 AAGAATAAATAGGAATAAGAAGG - Intergenic
1126428112 15:48551233-48551255 GAGGAAAAATAGAAGGACCAGGG - Intronic
1126525887 15:49653880-49653902 AAGGAAAAATAGATGGAAGATGG + Exonic
1126769962 15:52045965-52045987 AAGGAAAAAAAGAAGCAAAACGG + Exonic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1126948206 15:53849277-53849299 AAGGAAAAAATAAAGGAAGATGG - Intergenic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127238578 15:57084739-57084761 AAGAATATATAGAAGGCAAAGGG + Intronic
1127396904 15:58550368-58550390 AAGCATCAAGAGAAGGAAGAAGG + Intronic
1127537558 15:59904246-59904268 AGGGAGAAATGGAAAGAAGAAGG + Intergenic
1127788658 15:62378803-62378825 AAGGACAGAAAGAAGGAAGGAGG + Intergenic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128095837 15:64954743-64954765 AAGAACAAAAAGAAAGAAGAAGG - Intronic
1128518934 15:68362660-68362682 ATGGATAAATGGATGGAAGATGG + Intronic
1128585197 15:68843163-68843185 AAGGATAGAAAGAAGGGAGGGGG + Intronic
1128647065 15:69385530-69385552 AAAGAAAAAGACAAGGAAGAGGG - Intronic
1129303528 15:74641153-74641175 AGGGGTAAATAGAAGAGAGAAGG - Intronic
1129354172 15:74978091-74978113 AAGGATGAATAAAAGAAACAAGG + Intronic
1129736563 15:77969248-77969270 AAGGAAAGAAAGAAGAAAGAAGG - Intergenic
1130127412 15:81105350-81105372 AAGGAGGAAAAGAAGGAAGGAGG - Intronic
1130667442 15:85881568-85881590 AAGGAGTAGTGGAAGGAAGAGGG - Intergenic
1130671201 15:85914436-85914458 ACACATGAATAGAAGGAAGAAGG - Intergenic
1131283168 15:91037444-91037466 AATGAAAAATAAAAGGAAGATGG - Intergenic
1131744716 15:95434825-95434847 AAGGATGGATGGAAGGAAGGGGG - Intergenic
1132004092 15:98210628-98210650 AAGGAGAAAAAGAAGGAACAAGG + Intergenic
1132434345 15:101784825-101784847 AAGGAAAAAGGAAAGGAAGAAGG + Intergenic
1132516375 16:367984-368006 ATGGATAAACAGAGGGAATAGGG + Intronic
1132642865 16:985578-985600 AAAGAAAGATAGAAGGGAGAGGG - Exonic
1133204757 16:4226651-4226673 AAGGGTGAATGGAAGGATGATGG + Intronic
1133563462 16:6970838-6970860 CAGCATCAATAGAAGAAAGAAGG + Intronic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133816325 16:9200044-9200066 AAAGAGGAAAAGAAGGAAGAAGG - Intergenic
1133882363 16:9794928-9794950 AAGGATGAAGAGGAGGAGGAGGG + Intronic
1134410082 16:13996479-13996501 ATGGATGAATGGAAGAAAGAAGG - Intergenic
1135263325 16:21000003-21000025 AAGGAGAAAAGGAGGGAAGAAGG + Intronic
1135484944 16:22856041-22856063 AAGGATGAATAGTTGGTAGATGG + Intronic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1135891777 16:26363797-26363819 GAGGAGAAAGAGAAAGAAGAAGG - Intergenic
1135893734 16:26379785-26379807 AAGGACTAATCTAAGGAAGATGG + Intergenic
1135938744 16:26803019-26803041 AAGGAAGAAGAGAAGGAGGAAGG + Intergenic
1136065154 16:27753746-27753768 AAGGAGGAAAAGAAGGAAGGAGG - Intronic
1136104313 16:28018627-28018649 AAGAATAACAAGAAAGAAGAGGG + Intronic
1136738163 16:32482969-32482991 CAGGATAAATACAAGAAACAAGG + Intergenic
1136946120 16:34653039-34653061 AAAGAAGAAAAGAAGGAAGAAGG + Intergenic
1137039626 16:35598938-35598960 AAGGAGAAAGAGAAGGCAGCAGG - Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137968378 16:52959217-52959239 AAGAAGAAATAGAAAGAAGGAGG - Intergenic
1138009511 16:53364368-53364390 AAGAAAAAATAAAGGGAAGATGG - Intergenic
1138028482 16:53540538-53540560 AAGGAGAAAGAGAATGAAGGTGG + Intergenic
1138260308 16:55615436-55615458 AAAGAGGAACAGAAGGAAGATGG + Intergenic
1138339063 16:56276737-56276759 AAGGCTAAATAAAAGGAGGGAGG + Intronic
1138600530 16:58051494-58051516 AGGGATGGAAAGAAGGAAGAAGG + Intergenic
1138912733 16:61421861-61421883 AAGGATGAAAAGAATGAGGATGG + Intergenic
1138915954 16:61464714-61464736 AAAGAAAAAGATAAGGAAGAAGG - Intergenic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1140582243 16:76245203-76245225 AAAGAAAAACAGAAGGAAGTGGG + Intergenic
1140806201 16:78534581-78534603 AAGGTGAAATATAGGGAAGATGG + Intronic
1140856756 16:78984838-78984860 AAGGAGAAAGACGAGGAAGAAGG + Intronic
1140952130 16:79828583-79828605 AATGATAAATAGGACTAAGAAGG - Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141178356 16:81735318-81735340 ATGGATAGATAGATGGATGATGG + Intergenic
1141391323 16:83667070-83667092 AAGGATGGATAGATGGATGATGG + Intronic
1141421538 16:83921019-83921041 GAGGGTGGATAGAAGGAAGATGG + Exonic
1141421565 16:83921153-83921175 ACGAATAGATGGAAGGAAGATGG + Exonic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141856217 16:86683082-86683104 AAGGAAGAAAAGAAGGAAGGAGG + Intergenic
1141899339 16:86980379-86980401 ATGGATAAATAGATGATAGAGGG + Intergenic
1203014910 16_KI270728v1_random:346604-346626 CAGGATAAATACAAGAAACAAGG - Intergenic
1203033245 16_KI270728v1_random:619763-619785 CAGGATAAATACAAGAAACAAGG - Intergenic
1142632094 17:1231692-1231714 AAGGCTAAATTATAGGAAGAAGG - Intergenic
1143173564 17:4944066-4944088 ATGCATAAATACAACGAAGACGG + Intronic
1143179532 17:4975441-4975463 AAGAAGAAATGGAAAGAAGAGGG + Intronic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143301240 17:5912083-5912105 ATGGATGAATGGATGGAAGATGG - Intronic
1143301246 17:5912118-5912140 ATGGATGAATGGATGGAAGATGG - Intronic
1143440386 17:6967635-6967657 AAAGAGGAAGAGAAGGAAGAAGG + Intronic
1143469866 17:7166171-7166193 AAGGAGAAATTGGAGGAAGGGGG - Intergenic
1143701132 17:8660996-8661018 AAAGAAAAATAGAAGAAGGAAGG - Intergenic
1144169656 17:12647767-12647789 AAAAAAAAAAAGAAGGAAGAAGG - Intergenic
1144244743 17:13351947-13351969 AAGGAGAAGTAAAAGGAAAAGGG - Intergenic
1144300067 17:13915162-13915184 AAGGAAGAAAGGAAGGAAGAAGG + Intergenic
1144402636 17:14920985-14921007 ATTGGTAAATTGAAGGAAGATGG + Intergenic
1144454015 17:15404387-15404409 AAGGATTAATAAAATGAAGCAGG + Intergenic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144664475 17:17092548-17092570 AAGGAGAAAGAAAAGGATGAGGG - Intronic
1144741414 17:17584608-17584630 AAAGGTAAAGAAAAGGAAGATGG - Intronic
1145047801 17:19632104-19632126 AAACACAGATAGAAGGAAGAAGG - Intergenic
1145763284 17:27440334-27440356 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1145931779 17:28691172-28691194 AAGTACACAAAGAAGGAAGACGG + Intronic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146185356 17:30720829-30720851 AAAGAGAAAGAGAAGAAAGAAGG + Intergenic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1147205107 17:38831815-38831837 AAGGAAAAAAGGAAGGAAGAAGG - Intergenic
1147522419 17:41187201-41187223 AAGGAAACTTGGAAGGAAGAAGG - Intergenic
1147530186 17:41269038-41269060 AAGGAGAGAGGGAAGGAAGAAGG + Intergenic
1147606316 17:41775739-41775761 AAGGACAGGAAGAAGGAAGACGG + Intronic
1147725575 17:42564408-42564430 AAGGGTAAAAAGAGGGAAGGAGG - Intronic
1147770340 17:42863721-42863743 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1147932608 17:43992158-43992180 AAGGATAAATATTCAGAAGAGGG - Intronic
1148018379 17:44538421-44538443 TAGGATTTATGGAAGGAAGAGGG - Intergenic
1148545756 17:48517705-48517727 AAGGATAAAAAGAGGGAAGTGGG + Intergenic
1148676086 17:49445838-49445860 AAGGACAGAGAGCAGGAAGAGGG - Intronic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150541356 17:66103376-66103398 GAGGATAGAAAGAAAGAAGAGGG + Intronic
1150553378 17:66231437-66231459 TAGGATGAAAAGAAGGAGGAAGG - Intronic
1150702276 17:67458193-67458215 AAGGAAAAAGAGGAGGAAGCAGG - Intronic
1150809298 17:68344181-68344203 AAGGAAGAAGAGAAGGGAGATGG + Intronic
1150980382 17:70134977-70134999 AAGGAGAAAGGGAAGGATGAGGG - Exonic
1151018256 17:70582654-70582676 AAGAAAAAATAGGAGGAGGAAGG - Intergenic
1151024374 17:70660058-70660080 AAGGAGAGAGGGAAGGAAGAAGG + Intergenic
1151050916 17:70978240-70978262 AAGGAGAGATGGAGGGAAGAAGG + Intergenic
1151116948 17:71747065-71747087 AAGCATTAATGAAAGGAAGATGG - Intergenic
1151133909 17:71926625-71926647 AAGGATAGATAGTAGAAAGAGGG - Intergenic
1151941777 17:77296996-77297018 ATGGATAGATAGAAGATAGATGG + Intronic
1152188724 17:78875300-78875322 AAGGACAAACAGAAGGAAAGAGG + Intronic
1152322357 17:79614821-79614843 GAGGAGAAAAAGAAGAAAGAGGG + Intergenic
1152434793 17:80269518-80269540 ATGGATGAATAGAAAGAGGATGG - Intronic
1153187700 18:2503050-2503072 GAGAATAAAAAGGAGGAAGAAGG + Intergenic
1153645695 18:7194292-7194314 ATGCATAAATACAAGGAACATGG - Intergenic
1153837271 18:8975190-8975212 AAACATAAAAAGAATGAAGAAGG + Intergenic
1155231666 18:23780322-23780344 AAGGAAAGAAGGAAGGAAGAAGG + Intronic
1155442008 18:25871873-25871895 AAAGAAAAAGAGAAGGAAGAAGG + Intergenic
1155558896 18:27053425-27053447 AAGGAGCAAAAGAAAGAAGACGG - Intronic
1155636643 18:27963947-27963969 AGGGAGAGAGAGAAGGAAGAAGG - Intronic
1155692568 18:28643984-28644006 AAGGAAGAAAAGAAGGAAGGAGG + Intergenic
1156039337 18:32802705-32802727 AAGCAGAAATCTAAGGAAGAAGG - Intergenic
1156211181 18:34944758-34944780 AAGGAGCAAAAGAAGGAAGAAGG + Intergenic
1156259581 18:35432469-35432491 AAGGAAAAATAGAATGAGGGAGG + Intergenic
1156261802 18:35451457-35451479 AAGGATAAGGAGAGGGAAAAGGG + Intronic
1156280739 18:35635115-35635137 AAGGATACAATGCAGGAAGAAGG + Intronic
1156320666 18:36018748-36018770 AAGTATTAATAGAAAGAATATGG + Intronic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157468957 18:47973135-47973157 AAGAATAAGTAGATGGGAGAAGG + Intergenic
1158183972 18:54750420-54750442 AAGGAGGAAAAGAAGGAAGAAGG - Intronic
1158227333 18:55214854-55214876 AAGGAGAAATGGGAGGAGGAGGG - Intergenic
1158305790 18:56103833-56103855 AAGGAAACAAAGAAGGAAGGAGG + Intergenic
1158475432 18:57775325-57775347 AAAGAGAAAGAGAAGGAAGGAGG + Intronic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1158897721 18:61930875-61930897 CAGTAGAAATAGAAGCAAGATGG + Intergenic
1159079756 18:63724063-63724085 GAGGAGGAAGAGAAGGAAGAAGG - Intronic
1159126058 18:64226083-64226105 AAGTAGAAATAGAAAGAAAACGG + Intergenic
1159197928 18:65142695-65142717 AAGGATAATTACAAGAAAAAAGG - Intergenic
1159475562 18:68916566-68916588 AGGGAAAACTAGAAGGAAGCTGG + Intronic
1159571520 18:70119467-70119489 AAGGAGAAAGGGAAGGGAGAAGG + Intronic
1159725124 18:71947964-71947986 AAGGAAAAGAGGAAGGAAGAGGG + Intergenic
1160085357 18:75772291-75772313 AAAAATAAATAAAAGCAAGAGGG - Intergenic
1160280667 18:77487027-77487049 TAGGATAAATTGAAGGATGCAGG - Intergenic
1160676579 19:394395-394417 AAGGATAATGAGAAGGACAATGG + Intergenic
1160676628 19:394619-394641 AAGGATGAAGGGAAGGATGATGG + Intergenic
1160695323 19:481201-481223 AAGGATGATGAGAAGGATGATGG + Intergenic
1160695424 19:481648-481670 AAGGATAATGGGAAGGATGATGG + Intergenic
1161673089 19:5625065-5625087 AATGAAAAGGAGAAGGAAGAAGG - Intronic
1161905842 19:7155916-7155938 AAGAAGAAAAAGAAAGAAGAAGG + Intronic
1161933711 19:7357967-7357989 AAGCACATATAGAAGGAAGAGGG - Intronic
1161934599 19:7363919-7363941 ATGGATAAATAAAAGAATGAAGG + Intronic
1161934658 19:7364264-7364286 ATGGATAAATGAAAGGATGAAGG + Intronic
1162062839 19:8107259-8107281 AAGGATAAATGGACAGAAGGAGG + Intronic
1162164954 19:8745997-8746019 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162166025 19:8753461-8753483 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162167091 19:8760917-8760939 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162169100 19:8774673-8774695 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162180783 19:8867388-8867410 AAGGATAGATGGATGGATGATGG + Intronic
1162182280 19:8878307-8878329 AGTGATAAATGGAAGGAGGAAGG - Intronic
1162200841 19:9018853-9018875 GGGGATAAAGAGAAGGAACAAGG + Intergenic
1162227638 19:9237199-9237221 AAGGGAAAAGAGAAGTAAGAAGG - Intergenic
1162325278 19:9995645-9995667 AAGGAAAATAAGAAGAAAGAGGG + Intronic
1162404094 19:10463068-10463090 AAGAAGAAAGAGAAAGAAGAAGG - Intronic
1162450834 19:10753446-10753468 AAGGAAGAAGAGAAGGAAAAGGG - Intronic
1162803424 19:13123552-13123574 AAGAATGAAAAGAATGAAGAAGG + Intronic
1162872709 19:13598502-13598524 AAGGAAAAAAGGAAGGAAGGAGG + Intronic
1163245725 19:16092834-16092856 AAGCATAAAAAGAAGTAAGCAGG - Intronic
1163347690 19:16754245-16754267 ATGGATAGATGGATGGAAGATGG - Intronic
1163502217 19:17683071-17683093 ATAAATAAATAGAAAGAAGAAGG + Intronic
1163779696 19:19239861-19239883 AAAGATGAATGGAAGGAGGAGGG - Intronic
1164230870 19:23287096-23287118 TAGGAAAAAAAAAAGGAAGAAGG + Intergenic
1164292167 19:23878712-23878734 AAGGAAAAGTAGAAGAAAAAAGG + Intergenic
1164396927 19:27874012-27874034 AATGAATAAAAGAAGGAAGATGG + Intergenic
1164649906 19:29884233-29884255 AAGGAAAGGAAGAAGGAAGAAGG - Intergenic
1164662060 19:29983292-29983314 AAGACAAAGTAGAAGGAAGATGG - Intronic
1164718159 19:30408750-30408772 AAGGATAGATGGATGGATGATGG - Intronic
1164800651 19:31073540-31073562 AAGGAAAAAGGGAAGGAAGGAGG - Intergenic
1164915117 19:32046065-32046087 AAGGAAGAAAAGAAGGAAGGAGG + Intergenic
1164916781 19:32058340-32058362 AAGGAAAAAAGGAAGTAAGAAGG - Intergenic
1164918094 19:32067955-32067977 AAGGGTAAGGAGAAGCAAGAAGG - Intergenic
1165332404 19:35148005-35148027 AAGGAAAGAAAGAAGAAAGAAGG + Intronic
1165370221 19:35400740-35400762 AAGGAAGAAAGGAAGGAAGAAGG + Intergenic
1165456584 19:35915000-35915022 AAAGAAAAAAGGAAGGAAGAAGG + Intergenic
1165562748 19:36694697-36694719 AAGGATCAATACAAGGGAAATGG + Intronic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1166634720 19:44440298-44440320 AAAGAAAAAGAAAAGGAAGAAGG + Intronic
1166935673 19:46330942-46330964 AAGGATAAATGGATGGAGGTTGG + Intronic
1167387634 19:49173390-49173412 ATGGGTAAATGGATGGAAGATGG - Intronic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167862832 19:52298746-52298768 GAGAAGGAATAGAAGGAAGAAGG + Intronic
1167890751 19:52537237-52537259 GAGGAGTAATAGAGGGAAGAAGG + Intronic
925489250 2:4373838-4373860 ATGGATAAATGGATGGAATAAGG - Intergenic
925683889 2:6451978-6452000 CAGGATAAATAGGAGGACAAAGG + Intergenic
925851149 2:8083465-8083487 AAGGTTTAATACAAGGAAGTGGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925963896 2:9044785-9044807 AAGAAAAAATATTAGGAAGATGG + Intergenic
926481770 2:13407241-13407263 AAAGATAAATAAAAAGCAGAGGG + Intergenic
926517154 2:13861898-13861920 AAGGATAATTAGAGGCAAGAGGG + Intergenic
926818365 2:16824240-16824262 AAGGAGAGATAGAAGAAGGAAGG - Intergenic
926878167 2:17508920-17508942 AATAATAAAAAGACGGAAGAGGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927099033 2:19773222-19773244 AATGCTAAACAGAAGAAAGATGG + Intergenic
927280815 2:21304912-21304934 AAGGATAAATAGGAGAAATCAGG + Intergenic
927457956 2:23273606-23273628 AAGGAGAGAGGGAAGGAAGAAGG + Intergenic
927458251 2:23275879-23275901 AAGGAAAAAAAGAAGAAACATGG + Intergenic
927877330 2:26666998-26667020 AAGGAAAGAGAGAAGGAAGAAGG - Intergenic
928114198 2:28535282-28535304 AAGAAGAAATAGAATAAAGAGGG - Intronic
928335249 2:30392447-30392469 AAGGAAAATAAAAAGGAAGAGGG + Intergenic
928541227 2:32285425-32285447 AGGGATAAAAAGACTGAAGAAGG - Intronic
928958663 2:36898877-36898899 AAGGAGAGAGAGAAGGGAGAAGG + Intronic
929098227 2:38284337-38284359 TAGGAGAAAGAGAAGGTAGAAGG + Intergenic
929113914 2:38428488-38428510 AAGAAAAAATAGAAGAAGGAGGG - Intergenic
929391025 2:41468847-41468869 AAGGTTAAGGATAAGGAAGAAGG - Intergenic
929394443 2:41506833-41506855 AGAGATAAAAAGAAGGAAGAGGG + Intergenic
929430454 2:41881992-41882014 AAGGAAAGAGAGAAGGATGATGG - Intergenic
929606968 2:43241079-43241101 AAACATAAAAAAAAGGAAGAGGG - Intronic
929660472 2:43779393-43779415 AAGGAGAAAGAGAAGGCAGCAGG - Intronic
929692276 2:44084935-44084957 AAGGAAGAAAGGAAGGAAGAAGG - Intergenic
929766434 2:44847819-44847841 AAGAAGAAAGAGGAGGAAGAAGG - Intergenic
929993681 2:46811754-46811776 AAGGAGAAAAAGGAGGAAAAAGG - Intergenic
930236228 2:48891249-48891271 AAGGAAGAAAAGAAGGAAGCAGG - Intergenic
930239581 2:48922031-48922053 TAGTATAAATAGAAGAAAGTTGG - Intergenic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930539731 2:52690608-52690630 AAGGAAAGAAGGAAGGAAGAGGG - Intergenic
930794956 2:55379624-55379646 AAGGATAAAAATAAAGCAGAGGG + Intronic
930885896 2:56326007-56326029 AAGTATAATGATAAGGAAGAGGG + Intronic
931051573 2:58421128-58421150 AAAGAAAGATGGAAGGAAGAAGG + Intergenic
931082105 2:58785220-58785242 AAGGAGAAAGAGAGGGAAGTTGG + Intergenic
931322252 2:61182495-61182517 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
931376095 2:61709688-61709710 CATGATTAATAGAACGAAGAAGG + Intergenic
931680138 2:64739785-64739807 AAAGATAAATAGAATTAAGGAGG - Intronic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932516465 2:72355348-72355370 AATGATAAAATGAAAGAAGAAGG + Intronic
932539370 2:72636274-72636296 AAGGAAAAATGGAGGGAAGAAGG + Intronic
932733946 2:74241135-74241157 AGGCAGAAAGAGAAGGAAGAAGG + Intronic
933071862 2:77869244-77869266 AAGGAGACATACAGGGAAGAAGG + Intergenic
933148963 2:78891346-78891368 AAGGAGAGACAGAAGGAAGGAGG - Intergenic
933277594 2:80300595-80300617 AAGTCCAAATAGCAGGAAGAGGG - Intronic
933285137 2:80377248-80377270 ATGGATAAATGGAAGACAGATGG - Intronic
933543783 2:83682937-83682959 AACTATAAATAGAATGAATAAGG + Intergenic
934475975 2:94593785-94593807 GAGGATAAAGAGGAAGAAGAGGG - Intronic
935069304 2:99679606-99679628 AAGCAGAAATAAAAGGAAAATGG + Intronic
935173711 2:100629747-100629769 AAGGAAGCAAAGAAGGAAGAAGG - Intergenic
935403303 2:102682697-102682719 AAGGATAAAAAGAAGTGAGTGGG + Intronic
935665186 2:105505907-105505929 AAGGTTAATTAAGAGGAAGATGG - Intergenic
935787159 2:106559655-106559677 AAGGAAAGAAGGAAGGAAGAAGG - Intergenic
936636821 2:114268182-114268204 AAGTATAAATAGAAGTCTGATGG + Intergenic
936704803 2:115059178-115059200 AAAGATAAAAAGAAAGAAGAGGG + Intronic
936751442 2:115647113-115647135 ATGGACAGAAAGAAGGAAGATGG + Intronic
936768874 2:115887587-115887609 AAGGAAGGATGGAAGGAAGAAGG - Intergenic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
937043735 2:118839766-118839788 AAGGAAAAATGGAGAGAAGATGG + Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937229313 2:120388319-120388341 AAGGATAATGAGGAGGAAGGAGG + Intergenic
937543924 2:122990817-122990839 AAGGAAAAAAAGGAGAAAGAGGG + Intergenic
937609739 2:123846414-123846436 AGGGATGACTAGAAGGAGGATGG + Intergenic
937615835 2:123921358-123921380 AAGGAAAGAAAGAAGGAAGAAGG + Intergenic
937755866 2:125538139-125538161 AAGGAGTAATGGAAGGAAGATGG + Intergenic
937818214 2:126276433-126276455 AAGGAGAAAAGGAAGGGAGAAGG + Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938731102 2:134148459-134148481 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
938845731 2:135206776-135206798 AAGGATAGAAGGAAGGAAGGAGG + Intronic
938963209 2:136361485-136361507 ATGGAGAGAGAGAAGGAAGAAGG - Intergenic
939009571 2:136829914-136829936 AAAGATAAAAAGAGGCAAGAGGG - Intronic
939183637 2:138833679-138833701 AAGGATAAAGAAATGGAAGAAGG - Intergenic
939269541 2:139920232-139920254 AAGGAAAAAAAAAAAGAAGAGGG - Intergenic
939291313 2:140198923-140198945 AAGGAGAAAAAGAAAGAAGGAGG + Intergenic
939306836 2:140422668-140422690 AAGGATAAAAAGAAGAAACCAGG + Intronic
939451800 2:142384020-142384042 AAGGACAGAGGGAAGGAAGAAGG - Intergenic
939697507 2:145344539-145344561 AGAGATAAAGAAAAGGAAGAAGG - Intergenic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
939902841 2:147870820-147870842 AAGTATATAAAGAAGGAAGAGGG - Intronic
940245897 2:151615573-151615595 AAGAATAAATAGAAGTAGTAAGG + Intronic
940599125 2:155835213-155835235 AAGGAGAGATTGAAGGAAGAAGG + Intergenic
940634664 2:156284087-156284109 AAGGATAAATATAAAGAAAAAGG - Intergenic
940702743 2:157066308-157066330 AAGGAGGAAAGGAAGGAAGAAGG - Intergenic
940755617 2:157678569-157678591 AAAAATAAATATAAAGAAGAGGG + Intergenic
941124823 2:161571999-161572021 AAGAAAAAATTGAGGGAAGATGG - Intronic
941169672 2:162121246-162121268 CAGGATCAATAGACTGAAGACGG + Intergenic
941234845 2:162958756-162958778 AAGGATAAATTTAAAGAGGAAGG - Intergenic
941440092 2:165523868-165523890 AAAGAGCAATAGAATGAAGATGG - Intronic
941499318 2:166249828-166249850 TAGGATAACTAGAAAGAAGTTGG - Intronic
942208503 2:173647499-173647521 AAAGTAAAATAGAAGGAAGAAGG - Intergenic
942409896 2:175697964-175697986 AAAGATGGATAGAAGGAAGATGG + Intergenic
942468811 2:176238430-176238452 AAGGGTAAATATAAGGAGGGGGG - Intergenic
942482725 2:176406430-176406452 AAGGAAAAAGGGAAGGAACAGGG - Intergenic
942813724 2:180026607-180026629 AAGGAGAAATAGAGTGAAGTGGG + Intergenic
942978270 2:182046136-182046158 AAGGAGGAAAGGAAGGAAGAAGG - Intronic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943465394 2:188222901-188222923 AAAGACACACAGAAGGAAGATGG - Intergenic
943617921 2:190115216-190115238 AAGGAGAAGTAGAAAGGAGAGGG + Intronic
943656303 2:190512635-190512657 ATGGTTAAAGGGAAGGAAGAAGG + Intronic
943720086 2:191194814-191194836 ATGGATAGATAAATGGAAGAAGG - Intergenic
943826170 2:192396351-192396373 AAGGAAGAATGGAAGGAAAAAGG - Intergenic
943855450 2:192784049-192784071 AAGAAAAAAAAGAAGAAAGAAGG - Intergenic
943935703 2:193913469-193913491 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
944051427 2:195474399-195474421 AAGGAAAGAGAGAAGGAAGGGGG + Intergenic
944058617 2:195548305-195548327 AAGGAAAGGAAGAAGGAAGAGGG + Intergenic
944125347 2:196286587-196286609 AAGTGTACATAGAAGGCAGATGG - Intronic
944450298 2:199835664-199835686 AAGGAAAGATAAAAGGAAAAGGG + Intronic
944679615 2:202065206-202065228 AAGTATACATTTAAGGAAGAGGG - Intergenic
945949931 2:216029518-216029540 AATGATAAACACAAGGCAGAAGG + Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946294611 2:218773966-218773988 AAGAAGAAAGAGAGGGAAGAAGG - Intergenic
946323415 2:218968060-218968082 AAAGAGAGAGAGAAGGAAGAGGG + Intergenic
946460035 2:219860810-219860832 AAGGAAAAAAAGAAGGAAGAAGG + Intergenic
946513802 2:220389358-220389380 AAGGAAAGAAAGAAGGGAGAGGG - Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946558243 2:220883691-220883713 AAGGATAAAGAGAAGAATGGAGG + Intergenic
946832114 2:223737525-223737547 AAGGAGAAAGAGAAAGGAGAGGG - Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947336303 2:229088413-229088435 AAGGAAGAAAAGAAGGAAGGAGG + Intronic
947452097 2:230217917-230217939 AAGCATAAATAAAAGCATGAGGG + Intronic
948091800 2:235301757-235301779 AAGGATAACGAGGAGGGAGAAGG - Intergenic
948443243 2:238011357-238011379 AATGATGAATTGAAGGAGGAGGG - Intronic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
948556046 2:238812122-238812144 GAGGATGACGAGAAGGAAGAAGG - Intergenic
948608029 2:239148312-239148334 AAGGATAAAAAGATGAAAAATGG + Intronic
948724243 2:239922017-239922039 AAGGAAGGAAAGAAGGAAGAAGG - Intronic
948856915 2:240734544-240734566 GAGAATAAAAAGAAAGAAGACGG + Intronic
1168973174 20:1944933-1944955 GAGGATAGATGGATGGAAGAAGG + Intergenic
1169180299 20:3559957-3559979 AAGGATAAAAAAAGGGAAAAGGG - Intronic
1169305090 20:4482682-4482704 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1169764919 20:9138744-9138766 TAGAATAATTAGAAGGAATAAGG - Intronic
1170000765 20:11610846-11610868 AAGGAAAGAAAGAAGGAAGGAGG - Intergenic
1170034309 20:11973845-11973867 AAGGAAGAAGAGGAGGAAGAAGG + Intergenic
1170101494 20:12705385-12705407 AAGGAAGGAGAGAAGGAAGAAGG - Intergenic
1170465231 20:16616862-16616884 AAGGAAAAAGAGAAGGAAAGAGG + Intergenic
1170499341 20:16958575-16958597 AATGTTAAATAGAAGAAGGAGGG - Intergenic
1170550683 20:17473519-17473541 AAGGTTAAATAGGAGGAGGTTGG - Intronic
1170951410 20:20939663-20939685 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
1170970440 20:21111092-21111114 AATTTTAAATAGAAGGTAGAGGG - Intergenic
1170975813 20:21163321-21163343 AAGGAAAGAAAGAAGAAAGAAGG - Intronic
1171100274 20:22376740-22376762 TATGATAAATAAAAGAAAGAGGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1171980883 20:31627925-31627947 AAGTAGACATAGAGGGAAGATGG + Intergenic
1172092326 20:32442427-32442449 AAGGAAAAATGGTAGGAATATGG - Intergenic
1172811258 20:37649945-37649967 AAGGAAAAGAAGAAGGGAGAAGG + Intergenic
1172939116 20:38642633-38642655 AAGAATAAATGGAAGGGAGGTGG - Intronic
1173149965 20:40558603-40558625 AAGGAGAAAGGGAAGGAAGGAGG + Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173438873 20:43057389-43057411 AAGGAGGAAAAGAAGGAAGGAGG + Intronic
1173456831 20:43209563-43209585 ATGGAAAAATAGAAAGCAGATGG + Intergenic
1173787391 20:45804336-45804358 AAGGATGAACAGAAGGAAATAGG - Intronic
1173958418 20:47052607-47052629 AAAGATAAAAAGAAAGAAGCAGG - Intronic
1174001024 20:47374811-47374833 AAGGATAAAGAAGAAGAAGAAGG + Intergenic
1174214652 20:48906963-48906985 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
1174275508 20:49400967-49400989 ATGGATGAATAGAAGAAGGAAGG - Intronic
1174604100 20:51747997-51748019 AAGGATAGATAGAAGACAAAGGG - Intronic
1174785274 20:53426759-53426781 AAGGAAAAATAAAAGGAAGGTGG + Intronic
1175206862 20:57317778-57317800 ACGGATAAATGTAAGGAAGTGGG + Intergenic
1175273984 20:57754876-57754898 AAGGAAGGAGAGAAGGAAGAGGG - Intergenic
1175493216 20:59393271-59393293 AAGGATGAATGGATGGATGAAGG - Intergenic
1175687983 20:61045213-61045235 ATGGATGAATAGACGGAGGATGG - Intergenic
1175754120 20:61518548-61518570 GATGACAAATAGAAGGATGATGG - Intronic
1175770498 20:61620398-61620420 ATGGATAGATAGATGGATGATGG + Intronic
1175770505 20:61620469-61620491 ATGGATAGATAGATGGATGATGG + Intronic
1175983945 20:62755065-62755087 AAGGATAGATGGAAGGATGGAGG - Intronic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177543186 21:22521560-22521582 AAGAATTAATAGAAGCAAGCAGG + Intergenic
1177714447 21:24821181-24821203 AAGGAAAAAGAGAAGAAAAATGG - Intergenic
1178278118 21:31257608-31257630 ATGGATTGATGGAAGGAAGATGG - Intronic
1178416519 21:32409778-32409800 AAGGATGTTTAGAAGGCAGATGG - Intergenic
1179082378 21:38183749-38183771 AAGGTTCAGTAGAAGGAAGTGGG + Intronic
1179163460 21:38916801-38916823 AAGGAAGAAGAGAAGGAAGGAGG + Intergenic
1179163467 21:38916838-38916860 AAGGAAGAAGAGAAGGAAGGAGG + Intergenic
1179163477 21:38916883-38916905 AAGGAAGAAGAGAAGGAAGGAGG + Intergenic
1179262086 21:39766200-39766222 AAGGAGAAAGAGAATGAAGCAGG - Intronic
1179396218 21:41042817-41042839 AAGAAAAATAAGAAGGAAGACGG - Intergenic
1179474718 21:41635819-41635841 ATGGATATATAGAGGGATGATGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179623673 21:42634925-42634947 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623729 21:42635365-42635387 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623741 21:42635471-42635493 ATGGATGGATAGAAGGATGATGG - Intergenic
1179643700 21:42762679-42762701 AAAAATAAATAAAAGGAAGGGGG - Intronic
1180635389 22:17259310-17259332 AAGGAAGAAAGGAAGGAAGAAGG - Intergenic
1180894463 22:19319390-19319412 AAGTATAAAAATTAGGAAGAAGG - Intergenic
1180927652 22:19567252-19567274 AAGGTTAAATGGAAGGAAACGGG + Intergenic
1181180568 22:21065251-21065273 GAAGGTAAATAGAAGGGAGAAGG - Intergenic
1181615623 22:24052239-24052261 AGGGAGAAGTAGAAGCAAGAGGG + Intronic
1181887600 22:26033945-26033967 AAAGAAAAAGAGAAGAAAGAAGG - Intergenic
1181912877 22:26254410-26254432 AAGGAGGAAAGGAAGGAAGATGG + Intronic
1182015442 22:27035418-27035440 AAAGAAAAAAAGAAGGAAGAGGG - Intergenic
1182769141 22:32781096-32781118 AGGGATGCAGAGAAGGAAGAAGG - Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1184291801 22:43501374-43501396 AGGGAGAGAAAGAAGGAAGAGGG - Intronic
1184318084 22:43714331-43714353 AAGGAAGGATAGAAGGAGGAAGG + Intronic
1184345399 22:43909874-43909896 AAGGAAAGAAGGAAGGAAGAAGG + Intergenic
1184433988 22:44458916-44458938 AAGGATATGTAGGATGAAGATGG - Intergenic
1184434100 22:44459570-44459592 AAGGATATTTAGGATGAAGATGG - Intergenic
1184447212 22:44555730-44555752 AAGGAGAAAGAGAAAGAAAAAGG + Intergenic
1184609502 22:45593786-45593808 AAGGAAGGAGAGAAGGAAGAAGG - Intronic
1184635478 22:45825313-45825335 AAAGAAAAATAAAGGGAAGAGGG - Intronic
1184880738 22:47302849-47302871 ATGGATGAATAGAAGGTAGACGG - Intergenic
949725988 3:7045404-7045426 AAGGATAAGAAGAGGCAAGAGGG + Intronic
949730692 3:7109225-7109247 AAGGTTGAATTCAAGGAAGAGGG + Intronic
949868977 3:8570834-8570856 AAGGATAACAGGAAGGAAGGAGG - Intergenic
949891503 3:8736984-8737006 AAGAATAAAGAAAAGAAAGAAGG + Intronic
949977549 3:9474848-9474870 AAGGATGAAGAGAAAGAAGACGG + Intronic
949993569 3:9599445-9599467 AAGGATAACTTGGTGGAAGAGGG + Intergenic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950325280 3:12102683-12102705 AACAATAAATTGAAGGAATATGG - Intronic
950698021 3:14719420-14719442 AGGGATAGATGAAAGGAAGAGGG + Intronic
950757277 3:15185891-15185913 GAGAATAAATAGAAAGAAAATGG - Intergenic
951035584 3:17928353-17928375 AAGAATAAGTGTAAGGAAGAAGG + Intronic
951148427 3:19257384-19257406 AAGGATAACGAGAAAGAATAGGG - Intronic
951376804 3:21928240-21928262 AAGGAAGAAAGGAAGGAAGAAGG + Intronic
951418740 3:22458043-22458065 AAGGAAAAATGGAAGGAAGGAGG + Intergenic
951816806 3:26763696-26763718 AAGGAAAGAAGGAAGGAAGAAGG + Intergenic
951816829 3:26763788-26763810 AAGGAAAGAAAGAAGGAAGGAGG + Intergenic
951856228 3:27200234-27200256 AAGGATAAATCAAAGGGAAAGGG + Intronic
952038283 3:29230774-29230796 AAGGATGGATGGAAGGAAGGAGG - Intergenic
952053447 3:29414508-29414530 ATGGATAAATAGCAAGAAAATGG - Intronic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952222529 3:31339350-31339372 AAGGACAAATAGAAGAAAAAGGG + Intergenic
952392544 3:32892764-32892786 AGGGTTAAATGGAAGGAAAAAGG + Exonic
952590117 3:34942518-34942540 AAGGAAAAAGGGAAGGAAGAAGG - Intergenic
952692410 3:36225326-36225348 AAGGATGTATAGAACTAAGAAGG - Intergenic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
953941901 3:47106825-47106847 AAGGAAAAAGAAAAAGAAGAAGG + Intronic
954212022 3:49103256-49103278 AGGGATAAAAGGCAGGAAGAGGG - Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954693534 3:52408665-52408687 AAGGATTAATGGGAGAAAGAAGG - Intronic
954792002 3:53140182-53140204 AAAAATAAATAGAACCAAGAGGG + Intergenic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955307446 3:57848530-57848552 GAGGAAAAAGGGAAGGAAGAAGG - Intronic
955603441 3:60672774-60672796 AAGGCAAGAAAGAAGGAAGAAGG - Intronic
955772683 3:62401775-62401797 AAGGAAAAATATAAGTCAGAGGG - Intronic
955825634 3:62944178-62944200 AAGGATAAATCGTAGGCAGATGG - Intergenic
956063974 3:65377640-65377662 AAAAATAAAGAGAAGGAAGAGGG - Intronic
956095210 3:65708809-65708831 AAGAAGAAAAAGAAGAAAGAAGG - Intronic
956353142 3:68360485-68360507 AATGATGAGTAGAAGGAAAAGGG + Intronic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
956486025 3:69722724-69722746 AAGGAAAAAAGGAAGGAAGGAGG + Intergenic
956503820 3:69915832-69915854 AAGGATAAGGAAAAGGAACAGGG - Intronic
956569191 3:70674907-70674929 AAGAATAAGTAGAAGAAACAGGG - Intergenic
956690537 3:71874240-71874262 AAGGATAAATAGGTGGAGCACGG + Intergenic
956797602 3:72730809-72730831 AAGCAGACATGGAAGGAAGAAGG - Intergenic
956798339 3:72735914-72735936 AAGCAGACATGGAAGGAAGAAGG - Intergenic
956839960 3:73129789-73129811 AAAAAAAAAAAGAAGGAAGAAGG - Intergenic
956932409 3:74059897-74059919 AAGGAAACAAAGAAGGAAGCAGG + Intergenic
956983940 3:74674788-74674810 AAGGAAGGAAAGAAGGAAGAAGG - Intergenic
957640781 3:82850403-82850425 AGGGATAAGAAGAAAGAAGAAGG - Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957932881 3:86904831-86904853 ATGGAAAAAACGAAGGAAGAAGG + Intergenic
957936802 3:86954802-86954824 AAGAATAAAGGAAAGGAAGAAGG + Intronic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
959098220 3:101980528-101980550 AAGGACAGAAAGAATGAAGAAGG - Intergenic
959163864 3:102752113-102752135 AAGGAAGAAAGGAAGGAAGATGG - Intergenic
959182131 3:102994609-102994631 AAGGAAGAATAGAAGGAAGATGG + Intergenic
959189056 3:103086346-103086368 AAAGCCAAATAGAAGGAAGAAGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959327488 3:104956161-104956183 AAGGAAAGAAGGAAGGAAGAAGG + Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959440220 3:106365080-106365102 GAGGAAAAAAGGAAGGAAGAAGG - Intergenic
959454401 3:106541049-106541071 ACAGATAAAGAGAAGGAAGCAGG - Intergenic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
960202875 3:114859256-114859278 AAGGAAGAATGGAAGGAAGGAGG - Intronic
960288970 3:115861114-115861136 AAGGAAAGAAAGAAGGAAGGAGG - Intronic
960744992 3:120877662-120877684 AAGGAAAAAGAGGTGGAAGAGGG - Intergenic
960979385 3:123208077-123208099 GAAGATAAAGAGAAGGAAAAAGG - Intronic
961396834 3:126599364-126599386 AAGGAGAGAGAGAAGGAAAAAGG - Intronic
961881814 3:130067002-130067024 AAGGAAAGAAGGAAGGAAGAAGG - Intergenic
962015392 3:131434274-131434296 AAGGATGGATGGAAGGAAGAAGG + Intergenic
962144817 3:132829724-132829746 AAGGATAAATAGTTGGAAAATGG - Intergenic
962203048 3:133415742-133415764 AGGGATGAATAGAGGGGAGATGG - Intronic
962203303 3:133416796-133416818 AGGGGTGAATAGAAGGGAGAGGG - Intronic
962455993 3:135566245-135566267 AAGGAGAATTGGAAGGCAGATGG + Intergenic
962695397 3:137942745-137942767 ATGGATAATTAGAAGGCTGAAGG - Intergenic
962784751 3:138757593-138757615 AAGGAAGAAAGGAAGGAAGAAGG + Intronic
962832068 3:139151892-139151914 AAGGAAAAATAGAAAAAACAGGG + Intronic
962907256 3:139815424-139815446 AAGGAAAAATAGAGGGGAGAAGG - Intergenic
963006420 3:140730048-140730070 AAGTATAAATATATGGAAAAAGG + Intergenic
963108391 3:141665550-141665572 AAGGAAGGAAAGAAGGAAGAAGG + Intergenic
963644098 3:147892355-147892377 AAGAATAAATTGAAGGGAGTAGG - Intergenic
963681669 3:148385809-148385831 AAGTTTAATTAGAAGCAAGATGG - Intergenic
963896707 3:150694107-150694129 AAGAAAAAATAGGAGGAGGAAGG - Intronic
963938111 3:151075179-151075201 AAGGATGACAAGAAGGAAGTAGG + Intergenic
964117161 3:153148347-153148369 AAGGAGAAATAAAAGGAGAATGG - Intergenic
964137798 3:153365017-153365039 AAGGAAGAAAGGAAGGAAGAAGG - Intergenic
964472778 3:157072086-157072108 AAGGAAAAAAAGAGAGAAGAAGG + Intergenic
964574585 3:158151027-158151049 AAGGATAAATATAAGGTATATGG - Intronic
964734381 3:159901249-159901271 AAGGAGAAAGAGAATGGAGAGGG - Intergenic
964969511 3:162542274-162542296 AAGGAAAGAAAGAAGGAACAAGG - Intergenic
965023890 3:163273035-163273057 GAAGAGAAATAGGAGGAAGAAGG + Intergenic
965264904 3:166531061-166531083 AAGGAGAATTAGAGTGAAGAGGG + Intergenic
965282998 3:166777909-166777931 AATTATAAATAGAGGAAAGAAGG + Intergenic
965437636 3:168672065-168672087 AGGAAGAAATGGAAGGAAGAAGG - Intergenic
965494272 3:169378343-169378365 AAGGAAAGAAGGAAGGAAGAAGG + Intronic
966160352 3:176961177-176961199 AAGGCCAAATAGAATCAAGAAGG - Intergenic
966261011 3:177979418-177979440 AAGGAAAGATGGAGGGAAGAAGG + Intergenic
966319891 3:178690516-178690538 GAGGAGAATGAGAAGGAAGAAGG + Intronic
966387921 3:179421337-179421359 AAGGATTATCAAAAGGAAGACGG + Intronic
966431455 3:179834991-179835013 ACGAAGACATAGAAGGAAGATGG + Intronic
966693422 3:182764121-182764143 AAGGATGAAAGGAAGGAAGGAGG - Intergenic
966923255 3:184628256-184628278 AAGGAAAGAAAGAAGAAAGAAGG + Intronic
966923257 3:184628297-184628319 AAGGAAAGAAAGAAGAAAGAAGG + Intronic
966967706 3:185011766-185011788 TAGGATCAGTAGGAGGAAGAAGG + Intronic
967431329 3:189389289-189389311 AAGATTAAACAGAAGAAAGATGG - Intergenic
967471248 3:189864679-189864701 AAAAATAAAAAGAAGGAAGCAGG - Intronic
967568278 3:190997015-190997037 ATTGATAAATAAGAGGAAGAGGG - Intergenic
967732056 3:192916340-192916362 AAGAAAACCTAGAAGGAAGAAGG + Intronic
967739418 3:192988591-192988613 AAGGCTAATTAGCATGAAGAAGG - Intergenic
967986894 3:195101917-195101939 AAGGAGAAATGTAAGGAGGAAGG + Intronic
967998502 3:195185068-195185090 AAGGAAGGAAAGAAGGAAGAAGG + Intronic
968126380 3:196163584-196163606 AAGGACGGGTAGAAGGAAGAGGG - Intergenic
968159973 3:196418243-196418265 AAGGAAGAAAAGAAGGAAGGAGG + Intronic
968169329 3:196496846-196496868 AAGAATAAATATACGGAGGACGG + Intronic
968355867 3:198106232-198106254 GAGAAAAAATAAAAGGAAGAGGG - Intergenic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
968905999 4:3450810-3450832 AAGGAAGGAAAGAAGGAAGAAGG - Intergenic
969143548 4:5100726-5100748 AGGGAGGAAGAGAAGGAAGAAGG - Intronic
969143565 4:5100776-5100798 AAGGAATAAAGGAAGGAAGAAGG - Intronic
969270317 4:6095149-6095171 AAGGAGCAAAGGAAGGAAGAAGG + Intronic
969612280 4:8234121-8234143 ATGGATAAATGGATGGATGATGG - Intronic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970022683 4:11586909-11586931 AAGGATACAGAGAAGGAAGCAGG + Intergenic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970570650 4:17378399-17378421 AAGGAAGAAAGGAAGGAAGAGGG + Intergenic
970696949 4:18689383-18689405 ACGGAGAAATTGAAGGAAGAGGG - Intergenic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
970737548 4:19192298-19192320 AAGGATAAAAAGAAAGTGGAAGG - Intergenic
970765824 4:19547757-19547779 AGGCATAAGTAGAAAGAAGATGG + Intergenic
970914982 4:21321994-21322016 AAGGAAAAAAGGAAGGAAGGAGG + Intronic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971112356 4:23602552-23602574 AAGGAAAGGAAGAAGGAAGAAGG + Intergenic
971142474 4:23939116-23939138 AAGGAAAAGAAGAAGGAAAAAGG + Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971425022 4:26507532-26507554 ATGGATAAATCAATGGAAGAGGG + Intergenic
972103268 4:35447996-35448018 GAGGAAGAAAAGAAGGAAGAAGG + Intergenic
972132244 4:35852191-35852213 AAGGAGAGATGGAAGGAAGGAGG + Intergenic
972579839 4:40385486-40385508 AAGGAGGGAGAGAAGGAAGAAGG + Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
972709663 4:41582312-41582334 ATGGAAAACTAGATGGAAGATGG + Intronic
973064874 4:45776853-45776875 AAGAACAAAAAGAAGGAAGAAGG - Intergenic
973252867 4:48078940-48078962 AAGAAGGAAGAGAAGGAAGAAGG + Intronic
973835587 4:54806233-54806255 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
973835612 4:54806375-54806397 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
973956587 4:56069003-56069025 ACGGAGACATAGAAGGGAGAAGG + Intergenic
974093771 4:57339453-57339475 AAGGAAAGATGGAAGGAAGGAGG - Intergenic
974374494 4:61059282-61059304 AAAAATAAATAAAAAGAAGAAGG - Intergenic
974491885 4:62574293-62574315 AAGAAGAAATAGAGGAAAGAAGG + Intergenic
974535641 4:63170401-63170423 AATCACAAATAGAAGTAAGAAGG + Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
974753908 4:66179019-66179041 GAGGATAAATAGAACTAAGTGGG + Intergenic
974900133 4:67986687-67986709 AAGCAGCACTAGAAGGAAGAAGG + Intergenic
975019751 4:69471626-69471648 ATGGATAAAGAAAAGGTAGATGG + Intergenic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975245673 4:72118004-72118026 AAGGAAAAAAGGAAGGAAGGGGG + Intronic
975293616 4:72706620-72706642 AAGGAGAATGAGAGGGAAGAAGG + Intergenic
975788442 4:77920746-77920768 AAGGATGAATGGAAGGGAGAAGG - Intronic
975901858 4:79162877-79162899 AAAGATAAATAGAAGTAAATAGG + Intergenic
976297418 4:83486050-83486072 AAAGATGAACAGAAGGAAAAGGG + Intronic
976298764 4:83498433-83498455 AAGGAAAAAAAGAAGGAAAATGG + Intronic
976390946 4:84502924-84502946 AGGTAGAAATACAAGGAAGAAGG + Intergenic
976572751 4:86632627-86632649 GAGGAGAAAGAGAAAGAAGAAGG - Intronic
976626972 4:87195599-87195621 AAGGGTAGAGAGAAGGCAGAAGG + Exonic
976662075 4:87550219-87550241 AAGGACAAAGAGAGGGAAGGAGG - Intergenic
976908424 4:90268619-90268641 AAGGAAGAAAAGAAGGAAGTGGG + Intronic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977048303 4:92094414-92094436 AAGGATAAAGAGAAGAGGGATGG - Intergenic
977073250 4:92419713-92419735 AAGGTAAAAAGGAAGGAAGAAGG - Intronic
977146602 4:93448981-93449003 GAGGAAAAATAGGAGGGAGATGG - Intronic
977600225 4:98928186-98928208 AAGGATGAATGAATGGAAGACGG + Intronic
977700911 4:100021749-100021771 GAGGAAAGAAAGAAGGAAGAGGG - Intergenic
977786203 4:101037490-101037512 AAGGACAAATACAAGGAATTTGG - Intronic
978028490 4:103908467-103908489 AAAGAAAAATAAAAGGAGGAGGG + Intergenic
978048464 4:104164912-104164934 AAGGATGTAGAGAAAGAAGACGG + Intergenic
978240872 4:106514856-106514878 ATGGATAGATAGATGGATGATGG + Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978522073 4:109626995-109627017 AGGGGTAAATAGAACAAAGAAGG + Intronic
978861776 4:113458934-113458956 AAGGAAAAAGAGAAGGATAAAGG + Intronic
979200432 4:117971370-117971392 AAGGAGGAAGAGAGGGAAGAAGG + Intergenic
979443200 4:120777307-120777329 AAGGATAAATACAAAGAATTAGG + Intronic
979502173 4:121453236-121453258 AAGGAAAAAGAAAGGGAAGAAGG + Intergenic
979538442 4:121851396-121851418 AAGGAAAAAAGGAAGGAAGGAGG + Intronic
979616262 4:122746162-122746184 TAGGCTGAAGAGAAGGAAGAGGG + Intergenic
979724169 4:123940914-123940936 AAGGAGAAAGAGAAGACAGATGG + Intergenic
979766477 4:124470415-124470437 AAGGAAAGAAAGAAGGAAGGAGG - Intergenic
979865049 4:125744084-125744106 ATGGAAAGATAGAATGAAGAAGG + Intergenic
979909542 4:126344542-126344564 AAGGAAAAAGAGAGGGAAGGAGG + Intergenic
980140244 4:128906984-128907006 AAAGATAAATAGCAGTTAGATGG + Intronic
980269271 4:130563416-130563438 CAGGAAAAATTGAAGGAAAATGG - Intergenic
980269681 4:130567912-130567934 AAGAGAAAATAGGAGGAAGAAGG + Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
981036781 4:140177872-140177894 AAAGATAGAAAGAAAGAAGAAGG - Intergenic
981254382 4:142644238-142644260 GAGGAGAAAGAGAAGGAAGGGGG + Intronic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982049294 4:151484461-151484483 AAGGATACTAAGAAGGTAGAGGG + Intronic
982079182 4:151770857-151770879 AAGGAAAAAAAGAAGGATCAAGG + Intergenic
982149272 4:152434653-152434675 AAGGATATACAGAAGGGAGAGGG + Intronic
982152099 4:152471414-152471436 AAGGAAAAAGGGAAGGAAGGAGG + Intronic
982152104 4:152471438-152471460 AAGGAAAGAGAGAAGGAAGGAGG + Intronic
982226244 4:153170127-153170149 AAGGAGAAGGAGGAGGAAGAGGG + Intronic
982446135 4:155492522-155492544 ATGAAGACATAGAAGGAAGATGG + Intergenic
982866824 4:160523780-160523802 TAGGATAAATTGAAGGAATGTGG - Intergenic
983107029 4:163699723-163699745 AAATATAATTAGAAGCAAGATGG - Intronic
983332694 4:166351650-166351672 AAGGATAAATAAATGGATAATGG - Intergenic
983583425 4:169331339-169331361 AAGGAAAAACAGAAGGGATAAGG - Intergenic
983711672 4:170724529-170724551 ATGCTTAAATAGTAGGAAGAAGG - Intergenic
983741033 4:171134341-171134363 AAAAAAAAATAAAAGGAAGAGGG + Intergenic
984112799 4:175641313-175641335 AAGGGTAAATAGAAGCGAAATGG - Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984362288 4:178750331-178750353 AAGAATAAATACAGGAAAGAAGG - Intergenic
984389673 4:179112713-179112735 AAAGAAAATGAGAAGGAAGAAGG + Intergenic
984612390 4:181856118-181856140 AAGGAAGGAAAGAAGGAAGAAGG + Intergenic
984720802 4:182970889-182970911 AAGGAAAAAGGGAAGGAAAAAGG + Intergenic
984781217 4:183527436-183527458 AAGGAGAAAGAAAAGGAACAAGG + Intergenic
984804841 4:183742547-183742569 AAGAAAAAAAAAAAGGAAGAAGG - Intergenic
984835321 4:184014249-184014271 AAGGGTATGTAGAAGGAAAAAGG + Intronic
984998867 4:185465433-185465455 AAGGAAGAAGAGATGGAAGATGG - Intronic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
985993746 5:3584812-3584834 AAGGAGGAATGAAAGGAAGAAGG + Intergenic
986084998 5:4436062-4436084 AAGGAAAAATAAGAGGAATATGG - Intergenic
986202776 5:5593023-5593045 GAGGAAAAAAAGAAGGAAGCTGG - Intergenic
986412110 5:7491428-7491450 AAAGATAAATGGAAGAAAGTAGG - Intronic
986490907 5:8289190-8289212 AAGGAGAGAGAGAAGGAAGGAGG + Intergenic
986502439 5:8414982-8415004 AAGGAGGAATGGAAGGCAGAAGG - Intergenic
986761023 5:10879750-10879772 ATGGATAAATGGAAGGAGTAGGG - Intergenic
986879083 5:12147813-12147835 AAGGAAAGAAAGAGGGAAGAAGG - Intergenic
987213848 5:15712712-15712734 AAGGAAAAAAGGAAGGAAGGAGG + Intronic
987272680 5:16328186-16328208 ATGGATAATAAGAAGAAAGATGG + Intergenic
987630673 5:20467551-20467573 AAGGATAGAGAGAAGTGAGAAGG + Intronic
987687393 5:21223047-21223069 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
988005993 5:25411511-25411533 AAGGATAAAAACAAGGAACAAGG - Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988344129 5:30014756-30014778 GAGAAAAAATAGGAGGAAGAGGG - Intergenic
988403869 5:30799046-30799068 AAGAATAAAGAGAAGAAAGGAGG + Intergenic
988409134 5:30864079-30864101 AAGGAGAAAAAGAAGGAATGGGG + Intergenic
988848078 5:35150229-35150251 AAGAATAAAGAGAAAGAAGTGGG - Intronic
988921538 5:35946883-35946905 AAGGATCCATAAAAGGGAGATGG - Intergenic
989234616 5:39131985-39132007 AGAGATACATGGAAGGAAGAAGG + Intronic
989413954 5:41152022-41152044 AAGGAAGGATGGAAGGAAGAAGG + Intronic
989429666 5:41338070-41338092 GAGGAAATATACAAGGAAGAGGG - Intronic
989435613 5:41410122-41410144 AAAGATAAATAAAAGGAGGGGGG - Intronic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
990046226 5:51435123-51435145 AAAGATAAATAGAATAAAAATGG - Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990658748 5:57988232-57988254 AAAAAAAAAAAGAAGGAAGAAGG - Intergenic
990829955 5:59944841-59944863 AAGGAGGAAGAGCAGGAAGAGGG - Intronic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991501539 5:67282045-67282067 AAGGAAAAAGGGAAGGAAAAGGG - Intergenic
991622257 5:68557037-68557059 AAGGAAAAATGGAAGGAAGGAGG + Intergenic
991665060 5:68991366-68991388 AATGAGAAAAAGAAGAAAGAAGG - Intergenic
991974782 5:72175048-72175070 GAGGAAAGATAGAAGGAAGGAGG - Intronic
992144163 5:73828623-73828645 AAGGAGAAACAAAAGGAAAAAGG - Intronic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
992632071 5:78691196-78691218 AAGAACAAATAGAAAGAACAAGG + Intronic
992871360 5:81008671-81008693 AGGGAAGAAGAGAAGGAAGAGGG - Intronic
992899835 5:81283048-81283070 AAGAATAAAAAGAATGAAGGAGG - Intergenic
992961769 5:81962860-81962882 AGGGATAGATAGTAGAAAGATGG - Intergenic
993202334 5:84831513-84831535 GAGAAAAAATAAAAGGAAGAGGG + Intergenic
993292069 5:86086265-86086287 AAGGATAAGCATAAAGAAGAAGG + Intergenic
993326622 5:86546562-86546584 CAGGATTAAGAGAAGGGAGATGG + Intergenic
993481757 5:88432250-88432272 AAGGATAAAGAAATGGATGAAGG - Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
993818669 5:92585576-92585598 ATGGATATATAGTTGGAAGAGGG + Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
993967426 5:94374815-94374837 AAGGATTAAGAGGAGGAAGTAGG - Intronic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
994253321 5:97563081-97563103 AGGGATATGGAGAAGGAAGAAGG + Intergenic
994277883 5:97861022-97861044 AAGGATAAAGAGTGGGAGGAGGG + Intergenic
994304969 5:98192126-98192148 AAAGATATATAGGAAGAAGATGG - Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994934674 5:106239014-106239036 AAGAAAAAAGAGAAGGAAAAAGG + Intergenic
994952619 5:106483769-106483791 AAGGAGAAAGCCAAGGAAGAAGG + Intergenic
995205012 5:109469693-109469715 AAAGCTAGATAGAAGGAAGCAGG - Intergenic
995350818 5:111173364-111173386 AAGGAGAAATATAAAGATGAAGG + Intergenic
995669742 5:114588776-114588798 AAGGATGAAGGGAAAGAAGAGGG + Intergenic
995688662 5:114799238-114799260 AAGGAGGAATAGAGGGAAGGAGG + Intergenic
995762707 5:115580257-115580279 AAGGTTCAATACAAGGAATATGG + Exonic
995996318 5:118304811-118304833 AAGGAGAGATGGAAGGAGGAAGG + Intergenic
996172076 5:120305981-120306003 AAGGAAAAATAAAAGGACAAAGG - Intergenic
996174103 5:120333288-120333310 AACAATAAAAAGGAGGAAGAAGG - Intergenic
996343750 5:122467580-122467602 AAGAAGAAAAAGAAGAAAGAAGG + Intergenic
996656095 5:125938386-125938408 AAGGCGAAGGAGAAGGAAGAAGG - Intergenic
996755884 5:126934696-126934718 AAGGAAGAAAGGAAGGAAGAGGG + Intronic
996906862 5:128610713-128610735 AAGGATAAAGGGAAGGGAGTTGG + Intronic
997588949 5:135061294-135061316 AAGGAAAAAGAAAAGAAAGAAGG - Intronic
998377110 5:141698482-141698504 AAGGCGGAAGAGAAGGAAGAGGG - Intergenic
998377113 5:141698498-141698520 AAGGATGAATAGGAAGAAGGCGG - Intergenic
998477872 5:142436586-142436608 AAGGAAAAATAGAGGTGAGAAGG - Intergenic
998511553 5:142718449-142718471 ATGGGTAAATACAAGGAAGCTGG + Intergenic
998734672 5:145122975-145122997 AAGGAGAGAGAGAGGGAAGAAGG - Intergenic
998755498 5:145374973-145374995 ATGGATGAATTGAACGAAGAAGG - Intergenic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
998813697 5:145991568-145991590 ACGGAGAAAAAGAAGAAAGAGGG + Intronic
999185634 5:149706321-149706343 AAGGAAAGAAGGAAGGAAGAAGG - Intergenic
999213982 5:149916159-149916181 AAGAAAAAAGAGAAGGTAGACGG - Intronic
999292704 5:150437211-150437233 AAGAAAGAAAAGAAGGAAGAAGG + Intergenic
999524166 5:152384212-152384234 ATGGATAGATAGATGGATGATGG - Intergenic
1000444181 5:161299644-161299666 AAGGAGGAAGAGGAGGAAGAGGG - Intronic
1000452620 5:161408753-161408775 AAGGATAAAGAGAGAGATGAGGG + Intronic
1000593750 5:163189970-163189992 AAGGATAAAGAGAAAGGAGAAGG + Intergenic
1000713994 5:164617595-164617617 CAGGAGAAATAGCAGGAAAAGGG + Intergenic
1000873880 5:166611417-166611439 AAGGATAAATAGACTTTAGAAGG + Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1000927928 5:167216308-167216330 AAGGATCACCAGGAGGAAGAAGG + Intergenic
1000939863 5:167347640-167347662 AAGGAAGGATGGAAGGAAGAAGG - Intronic
1001139039 5:169128164-169128186 AAGCATAAATAGAAGAAAATAGG + Intronic
1001177471 5:169484616-169484638 AAGCATAAAGAAAAGGAAAAGGG - Intergenic
1001545944 5:172570684-172570706 AGGGAAAGATGGAAGGAAGAAGG + Intergenic
1001545966 5:172570757-172570779 AGGGAAGAATGGAAGGAAGAAGG + Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001791222 5:174459414-174459436 AAGGCAAAAAAGAAGAAAGAGGG + Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1002110636 5:176908404-176908426 CAAGATAAATAGAGGGAAGAGGG + Intronic
1002811315 6:632528-632550 ATGGATAAAATGAAGGAAAAGGG + Intronic
1002831722 6:827785-827807 AAGGAGAAATAAAATGAAGAAGG - Intergenic
1002934928 6:1663468-1663490 AAGGATAAAAGCAAGGAAAAGGG - Intronic
1002938938 6:1699265-1699287 AAGAAGAAAAATAAGGAAGATGG + Intronic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003477610 6:6498538-6498560 GAGGATAAAGGGGAGGAAGAGGG - Intergenic
1003691159 6:8354996-8355018 AAGGATAGATGGATGAAAGATGG + Intergenic
1003709624 6:8574892-8574914 AAGGAAAGAAGGAAGGAAGACGG - Intergenic
1003797074 6:9616398-9616420 AGGGAGAAAAAGAAGGAAGCAGG + Intronic
1003872675 6:10414483-10414505 ATGAATGAATAGAAAGAAGAAGG + Intronic
1003941777 6:11035434-11035456 AAGGATGGATAGAAGGAGCATGG - Intronic
1004446200 6:15701137-15701159 AAGCATGAATAGAAGGAGGGAGG + Intergenic
1004558973 6:16728905-16728927 AGGAATAAATAGAAGGAGAATGG - Intronic
1004581500 6:16958623-16958645 TAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1004798165 6:19113116-19113138 AAAGAAAAAGAGAAGGAAGAAGG - Intergenic
1005171404 6:22989403-22989425 AAGAATCAATATAATGAAGATGG - Intergenic
1005500614 6:26426141-26426163 AAGGAAAAAAAGAGGGAAGTAGG - Intergenic
1006137732 6:31906119-31906141 AAGGAGAAAGAGAAAGAAGTTGG - Intronic
1006243216 6:32705764-32705786 AAAGACAAATAAAAGAAAGAAGG + Intergenic
1006557872 6:34884418-34884440 AAGGGTATATGGAAGGATGAAGG + Intronic
1006972517 6:38061291-38061313 AAGGGTAATCAGAAGGAAAAAGG - Intronic
1007263771 6:40582197-40582219 CAGGAAACATGGAAGGAAGAGGG + Intronic
1008075438 6:47140549-47140571 AAGGCCATGTAGAAGGAAGAAGG + Intergenic
1008077877 6:47164644-47164666 AAGGTTAAAGAGAATGGAGAAGG - Intergenic
1008142884 6:47852413-47852435 AAATAAAAATAGAAGGAAGGTGG + Intergenic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009064577 6:58443501-58443523 AAAGATAAAAAGTAGAAAGAAGG + Intergenic
1009187940 6:60596174-60596196 AAAAATAAGAAGAAGGAAGAAGG - Intergenic
1009353846 6:62715032-62715054 AAAAATAAAAAGAAAGAAGAAGG + Intergenic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1009856735 6:69274551-69274573 AAGGACACAAGGAAGGAAGAGGG - Intronic
1010106465 6:72175298-72175320 AAGAATAAATATAAGCATGAAGG - Intronic
1010298641 6:74231983-74232005 AAGGAAAAAGAGAAGAAAAAAGG - Intergenic
1010298672 6:74232129-74232151 AAGGATAAAAGGAAGGAAAGAGG - Intergenic
1010389279 6:75319069-75319091 GAGGATGAAGAGGAGGAAGAAGG - Intronic
1010431415 6:75782476-75782498 AAGGAAAAATGGAAAGAAAAAGG + Intronic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010704394 6:79090110-79090132 AAGGATGGAAGGAAGGAAGAAGG - Intergenic
1011338747 6:86288436-86288458 AAGAAGATATACAAGGAAGATGG - Intergenic
1011545088 6:88474693-88474715 AAGGAAAAATAAGAGCAAGAAGG - Intergenic
1011860797 6:91753639-91753661 AAGGATGAAAGGAAGGAAGCAGG - Intergenic
1012143771 6:95656003-95656025 AAGGCCAAAAAGTAGGAAGAAGG + Intergenic
1012232525 6:96777215-96777237 AAGGAGAAGGAGAAGAAAGAGGG - Intergenic
1012477588 6:99631610-99631632 AAGGAGGAATTTAAGGAAGATGG + Intergenic
1012523534 6:100149871-100149893 AAGGAAGAATGGTAGGAAGATGG - Intergenic
1013815001 6:114087150-114087172 AAGGGTGAATTGGAGGAAGAGGG - Intronic
1014208721 6:118685807-118685829 AAGGAGAAAAAGGAGGAAAAAGG + Intronic
1014505546 6:122249649-122249671 TAGGAAAGAAAGAAGGAAGATGG + Intergenic
1014528047 6:122524115-122524137 AAGGAGGAGGAGAAGGAAGAAGG - Intronic
1014681413 6:124435160-124435182 CTGGATAACTAGAAGGAATATGG + Intronic
1014775493 6:125504350-125504372 TAGGATGGATAGAAGCAAGATGG - Intergenic
1014820897 6:125987322-125987344 AAGGATGAATAGGAGTTAGAGGG + Intronic
1015114087 6:129627616-129627638 AAGGAAAAATAGAGAGAGGAAGG + Intronic
1015128952 6:129788079-129788101 AAGGATGCATGAAAGGAAGATGG + Intergenic
1015164150 6:130184752-130184774 ATGGATGAATGGATGGAAGATGG - Intronic
1015219948 6:130793289-130793311 AATGAGAAATAGAAGAAAAAAGG + Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015385896 6:132623035-132623057 AAGGAAAAAAGGAAGGAAGGAGG - Intronic
1015464805 6:133536993-133537015 AAGGATAAGAAGAAGGAACATGG - Intergenic
1015478025 6:133675319-133675341 AAGGAGGAAATGAAGGAAGAAGG + Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1015669779 6:135675321-135675343 AAGAATAAATAGAAATATGAGGG - Intergenic
1016008655 6:139115507-139115529 AAGGATAAAGGGAAGGAAAAGGG - Intergenic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1016744476 6:147563515-147563537 AAGGAAAGTTGGAAGGAAGAAGG - Intronic
1017041134 6:150309327-150309349 AAGGAAAGACAGAAGGAAGGAGG + Intergenic
1017540212 6:155393915-155393937 AAGGATATATTTAAGGAAGGAGG - Intergenic
1017634549 6:156431077-156431099 AAGGGTAAGTTGAGGGAAGATGG - Intergenic
1017652069 6:156593119-156593141 AAAGAGAGAAAGAAGGAAGAGGG + Intergenic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018204289 6:161422687-161422709 AAGGAAAAATAGAGGAAAAAAGG + Intronic
1018378095 6:163232478-163232500 AAGGAAGAGGAGAAGGAAGAAGG + Intronic
1018415943 6:163602133-163602155 GAGGACAAAGAGGAGGAAGAGGG + Intergenic
1018463033 6:164017205-164017227 ATGGAGAAATAGAGGGACGAGGG - Intergenic
1018689308 6:166332027-166332049 AAAGATCAATACACGGAAGATGG - Intronic
1018779161 6:167046377-167046399 AGGGAAAAATGGAAGGAGGAAGG + Exonic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1019479979 7:1261893-1261915 ATGGATAGATAGATGGATGATGG - Intergenic
1019567286 7:1690608-1690630 ATGGATAAATGGATGGATGAAGG + Intronic
1020137628 7:5595583-5595605 AAGGATGAATAGAAGGTGGCAGG + Intronic
1020576914 7:9945185-9945207 AAGGAAAACTAGAAATAAGAGGG - Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020913668 7:14165470-14165492 AAGGATTTATAGCAGGAATAGGG - Intronic
1020940989 7:14537094-14537116 AAGAATAAATATAACCAAGAAGG + Intronic
1020961695 7:14812710-14812732 AAGAATTAATAGAGTGAAGAGGG - Intronic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021252541 7:18348710-18348732 AGGGCTAAAGAGAAGGCAGAAGG - Intronic
1021366098 7:19779948-19779970 ATGGAAAAATAAAAGGAAAAAGG + Intergenic
1021483450 7:21143597-21143619 AAGGATAAAGAAAGAGAAGAAGG + Intergenic
1021956208 7:25827038-25827060 AAGGAAAGAGGGAAGGAAGAAGG + Intergenic
1021993508 7:26158423-26158445 AAGAATTGATGGAAGGAAGATGG - Intronic
1022081731 7:27029218-27029240 AAAGAAAAGTAGAAGGAAAATGG - Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022309005 7:29177621-29177643 ATAGATAAACAGATGGAAGAAGG - Intronic
1022343211 7:29487653-29487675 AAGGAGAAAAAGAAGAAAGGAGG - Intronic
1022550550 7:31235256-31235278 AAAAATAAAAAGAAGAAAGAAGG - Intergenic
1022782154 7:33596837-33596859 ATGGAAGAATAGAAGGAAGGGGG - Intronic
1022867848 7:34441020-34441042 AAATAAAAATAGAAGGGAGAGGG + Intergenic
1023241159 7:38149116-38149138 AAGGAAGGATGGAAGGAAGAAGG + Intergenic
1023622582 7:42088103-42088125 AAGGAGAAATAGAAGAAAAATGG - Intronic
1023641312 7:42261917-42261939 AAGAAGAAAGAAAAGGAAGAAGG - Intergenic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1023737498 7:43247971-43247993 AAGGAAAGAAGGAAGGAAGAAGG + Intronic
1024071003 7:45785159-45785181 AAGGAAAAAAGGAAGGAAGGAGG - Intergenic
1024491688 7:49993334-49993356 AAGGCAAAATAAAAGGAAAAGGG + Intronic
1024773930 7:52759910-52759932 AAGAAGAAATGGAAGGAGGAGGG + Intergenic
1024912486 7:54461276-54461298 AAGGAAAAAAGGAAGGAAAAAGG - Intergenic
1024957737 7:54942498-54942520 AAGGAAAGAAGGAAGGAAGAAGG + Intergenic
1025174653 7:56792490-56792512 CAAGATAAAAAGGAGGAAGACGG + Intergenic
1025697150 7:63783924-63783946 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025826902 7:65018035-65018057 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025879309 7:65519774-65519796 AAAGAAAAAAGGAAGGAAGAAGG - Intergenic
1025885109 7:65582667-65582689 AAAGAAAAAAGGAAGGAAGAAGG - Intergenic
1025898078 7:65722598-65722620 AAGGAAAAAGGGAAGGAGGAAGG - Intergenic
1025914448 7:65854453-65854475 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025964882 7:66259898-66259920 AAGGATAAATAGGGGGAACACGG - Intronic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026275120 7:68869941-68869963 AAGGATAAATGGATGGATGGTGG + Intergenic
1026275397 7:68871784-68871806 ATGGATAGATAGACGGATGATGG - Intergenic
1026319256 7:69254737-69254759 AAGGAAAGAAAGAAGGAAGGAGG + Intergenic
1026559081 7:71433129-71433151 AAGTAAAAATAGAGGAAAGATGG + Intronic
1026595728 7:71732932-71732954 AAGGATAAAAAGAAAGAAAAGGG + Intergenic
1026632402 7:72048781-72048803 AAGGAAAAAAGGAAGGAGGAAGG - Intronic
1026650020 7:72209025-72209047 AAGGAGAGAGAGAAGGAAGGAGG - Intronic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1026967453 7:74449263-74449285 AAGGAAAGAAAGAAAGAAGAGGG - Intergenic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1027845693 7:83371220-83371242 AATGATAAAAAGAACAAAGATGG + Intronic
1027876427 7:83775489-83775511 AACTATAAATAGATGAAAGATGG + Intergenic
1028167567 7:87555984-87556006 AAGGAGAAATAAAGGAAAGAAGG + Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1028590629 7:92489931-92489953 AATGAAAGATGGAAGGAAGAGGG + Intronic
1028633585 7:92962515-92962537 AAGGATACATAGGAGGTTGATGG + Intergenic
1028921374 7:96314101-96314123 AAGGAGAAGGAGGAGGAAGAAGG + Intronic
1029165277 7:98584864-98584886 AAGGAGAAAAGGAAGGAAGGAGG - Intergenic
1029178657 7:98683679-98683701 AAGGAAGGATGGAAGGAAGAAGG - Intergenic
1029249358 7:99224967-99224989 AAAGAAAGAAAGAAGGAAGAGGG - Intergenic
1029322527 7:99777250-99777272 AAGGAAAAAAAAAAAGAAGAGGG + Intronic
1029493429 7:100884523-100884545 AAGGATGAGAAGAAGGAAGACGG + Exonic
1029495062 7:100892146-100892168 AAGGAGACAGAGAAGGCAGAGGG - Intronic
1030066123 7:105660534-105660556 AAGGACAAGTAGTAGGAAGGAGG - Intronic
1030382874 7:108833071-108833093 ACAGTTAAATAGAAGGAATAAGG - Intergenic
1030417080 7:109258580-109258602 TTGGACAAATAGAAGGATGAAGG - Intergenic
1030562483 7:111107194-111107216 GAGGAAAGAGAGAAGGAAGAAGG - Intronic
1030712803 7:112771750-112771772 AAAGATAAATAGAAGTAGTATGG - Intronic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1031113749 7:117644417-117644439 AAAGAAAAAAAAAAGGAAGAAGG + Intronic
1031148579 7:118026071-118026093 AATGATAAGTAAAAAGAAGATGG + Intergenic
1031448093 7:121879786-121879808 AAGGAAAAATAGAAGGAAGGAGG - Intronic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031783042 7:125994226-125994248 AAAGAAAGAAAGAAGGAAGAAGG - Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032439749 7:131933339-131933361 AAGGAAAGAAGGAAGGAAGAAGG + Intergenic
1032725212 7:134584556-134584578 ATGGATAAATGGATGGAAGCAGG + Intergenic
1033084563 7:138330255-138330277 AAGGAGGAATAGAGGGTAGAAGG - Intergenic
1033352911 7:140576787-140576809 GAGCACAAAAAGAAGGAAGAGGG + Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033625064 7:143102491-143102513 AAGGAAAAAAATATGGAAGAGGG + Intergenic
1033832600 7:145271570-145271592 GAGGAAGAAAAGAAGGAAGAAGG + Intergenic
1033907360 7:146222007-146222029 AAAGAGAAAAGGAAGGAAGAAGG + Intronic
1034255672 7:149723481-149723503 GAGGACAAATTGAAGGAAGTGGG - Intronic
1034312875 7:150105066-150105088 AAAGAAAAAAAGAATGAAGAAGG - Intergenic
1034633617 7:152550131-152550153 AAGGACAAATTTAAGGAAAATGG - Intergenic
1034721555 7:153298855-153298877 CAGGATAAATAGAAGACAGAAGG - Intergenic
1035067116 7:156114334-156114356 AAGAAAGAATAGAAGGAAGAAGG + Intergenic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1035776588 8:2191868-2191890 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1035850151 8:2910934-2910956 AAGGAGAAATGGAAGGATTATGG + Intergenic
1036588207 8:10144612-10144634 AAGGAAAAAAAGCAGGGAGAGGG - Intronic
1036658872 8:10694980-10695002 ATGGATAAGTGGAAGGATGATGG + Intronic
1036962921 8:13265670-13265692 AAGGAAGAAGAGAAGGAAGAAGG - Intronic
1037601567 8:20400628-20400650 AAGAATAAGTAAAGGGAAGATGG - Intergenic
1037653748 8:20865451-20865473 AAAGATAGAAAGAAGGAAAAAGG - Intergenic
1037676043 8:21051453-21051475 AGGGATAAATAGGAAGAAGCTGG + Intergenic
1037726283 8:21485017-21485039 AGGGTTATATAGCAGGAAGATGG + Intergenic
1037745110 8:21637054-21637076 AAGGGTAAATGGAAGAATGAGGG - Intergenic
1037978471 8:23231997-23232019 TAGGATAATTAGGAGAAAGAAGG + Intergenic
1038114508 8:24538212-24538234 ATGGAAAAATCCAAGGAAGAGGG + Intergenic
1038279635 8:26152284-26152306 AAGGAAGAATGCAAGGAAGAAGG - Intergenic
1038303259 8:26375627-26375649 AAGGATGAGAAGAGGGAAGAAGG - Intergenic
1038340366 8:26680711-26680733 AAGGATGGAAGGAAGGAAGAGGG - Intergenic
1038544344 8:28413572-28413594 AAGGAAGAAAGGAAGGAAGAAGG - Intronic
1038653479 8:29427414-29427436 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1038663404 8:29516802-29516824 AAGGAAAGAAGGAAGGAAGAAGG + Intergenic
1039000206 8:32971543-32971565 AGAGATAAATAGTATGAAGATGG + Intergenic
1039053552 8:33515621-33515643 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1039151546 8:34512236-34512258 AAGGATGGAAAGAAGGAAGGAGG - Intergenic
1039312391 8:36331225-36331247 AAGGAGTAATAGAAAGAATAGGG + Intergenic
1039762164 8:40589712-40589734 AAGGAAAGGAAGAAGGAAGAAGG - Intronic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039816570 8:41099993-41100015 ATAAATAAAAAGAAGGAAGAAGG - Intergenic
1039816616 8:41100317-41100339 AGTGATAATTAGAAGGAAGAAGG - Intergenic
1039953033 8:42187148-42187170 GATGATAAATAGACGGTAGATGG - Intronic
1040112726 8:43576990-43577012 AAGGATAAAAAGTAGAAAGAAGG + Intergenic
1040515197 8:48128840-48128862 AAAGAAAGAAAGAAGGAAGAGGG - Intergenic
1040562588 8:48537398-48537420 AAGGATATATGTTAGGAAGATGG - Intergenic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041097142 8:54361463-54361485 AAGGAAAGAGGGAAGGAAGAAGG - Intergenic
1041097173 8:54361598-54361620 AAGGAGAAAAGGAAGGAAGAAGG - Intergenic
1041411412 8:57560521-57560543 AAGGAGAAAGAGAAGGGAGGAGG - Intergenic
1041516464 8:58704492-58704514 AAGGAGAAAGAGAAGAAAGCAGG + Intergenic
1041539758 8:58970375-58970397 GGGGAGAAATAGAAGGAAGTGGG - Intronic
1041610487 8:59841059-59841081 AAGCATAAAGAGAAAGAAAAGGG + Intergenic
1041718521 8:60953941-60953963 AAGGATGAATATGTGGAAGAAGG - Intergenic
1041854921 8:62440672-62440694 AAGAAGAAAAAGAAGGAAGGAGG - Intronic
1041997287 8:64078430-64078452 AAGGAATGAAAGAAGGAAGAAGG - Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042337664 8:67645519-67645541 AAGTATAAATTGAAAGATGAAGG + Intronic
1042397825 8:68311905-68311927 AGGGAAAAAGAGAAGGAAGAAGG - Intronic
1042398185 8:68315173-68315195 ATGAATAAATATGAGGAAGAAGG - Intronic
1042426955 8:68660336-68660358 AAGAATAAAATAAAGGAAGATGG - Intronic
1042513926 8:69640113-69640135 AAGGAAGAAAGGAAGGAAGAAGG + Intronic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1042863918 8:73340235-73340257 AAAGATAAAAAGAAGGGAAAAGG + Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043215925 8:77587900-77587922 AAGGATGAAGAGTAGGATGATGG - Intergenic
1043256297 8:78141913-78141935 AAGGAGAAAGAGGAAGAAGATGG - Intergenic
1043277882 8:78423149-78423171 AGGAATAAATTTAAGGAAGAAGG - Intergenic
1043341584 8:79246504-79246526 AAGGATAAACAGAATCAATAAGG - Intergenic
1043379796 8:79690340-79690362 AAGGACACATAGAAGGCATAAGG - Intergenic
1043398861 8:79864470-79864492 GAGGAAAAAGAAAAGGAAGATGG - Intergenic
1043457522 8:80427281-80427303 AAGGATAAAAATATTGAAGATGG - Intergenic
1043674080 8:82927449-82927471 AAAGAAAAACAGAAGGAAGGAGG + Intergenic
1044358309 8:91252061-91252083 AAGGAAAATTAGAAGAAAGAGGG + Intronic
1044759479 8:95502863-95502885 AAGGAGAAAGAAAAGAAAGAAGG + Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045062976 8:98424580-98424602 AAAGAAAAACAGAAGGCAGAGGG + Intronic
1045159204 8:99518573-99518595 AAGGCAAAATAGTAGGAAGGTGG - Intronic
1045377597 8:101590674-101590696 AGGTATAAAGAGAAGGAACATGG - Intronic
1045605028 8:103763436-103763458 AAGGAAAAAAAAAAAGAAGAAGG + Intronic
1045682732 8:104679944-104679966 AAAGAAAAAAAGAAGGAGGAAGG - Intronic
1045755277 8:105534204-105534226 GAGGAAGAAAAGAAGGAAGAAGG - Intronic
1045918695 8:107504129-107504151 AGGGAAAAAGAGAAGAAAGAAGG - Intergenic
1046184472 8:110694611-110694633 AAGTATGAAAAGGAGGAAGAAGG + Intergenic
1046220793 8:111211584-111211606 AAGGAGAAAGAAAGGGAAGAGGG - Intergenic
1046406400 8:113778503-113778525 AAGCAAAAATAAAAAGAAGATGG + Intergenic
1046542410 8:115603542-115603564 AAGGATAAATAAATGGACTACGG + Intronic
1046609078 8:116404224-116404246 AAGGAAAAAGAAAAAGAAGATGG - Intergenic
1046706741 8:117462014-117462036 AAGGAAAAAGAGAAGGAAAGAGG + Intergenic
1046924689 8:119773572-119773594 AAGTAAAAATATGAGGAAGATGG + Intronic
1046976205 8:120280874-120280896 AAGAATAAACATAAGGAATATGG - Intronic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047151766 8:122272081-122272103 AAGGGAAGAAAGAAGGAAGAAGG - Intergenic
1047525033 8:125625897-125625919 AAGGATAAAAGGAGGGAGGAGGG - Intergenic
1047559914 8:125975768-125975790 TAGGTTTAATAGAAGGAAAAAGG - Intergenic
1047781090 8:128111705-128111727 AAGGAAAAAGAGAGGGCAGAGGG + Intergenic
1047930746 8:129726357-129726379 AAGGAGAAAGACATGGAAGAGGG + Intergenic
1048053873 8:130845849-130845871 AAGGAAGGATAGAAAGAAGAAGG + Intronic
1048126672 8:131643111-131643133 AAGGAGAGAGGGAAGGAAGAAGG + Intergenic
1048232173 8:132653206-132653228 ATGGATGGATAGATGGAAGAAGG + Intronic
1048389120 8:133944364-133944386 AAGGAAGGAAAGAAGGAAGAAGG - Intergenic
1048535354 8:135289212-135289234 TCTGATAAAAAGAAGGAAGAAGG + Intergenic
1048551653 8:135438887-135438909 AAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1048551657 8:135438914-135438936 AAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1048551711 8:135439203-135439225 AAGGAAAGAAAGAAGGAATAAGG + Intergenic
1048777217 8:137960407-137960429 GAGGAAGAAGAGAAGGAAGAGGG - Intergenic
1048821666 8:138385845-138385867 AAGGACACATAGAAGGAAACGGG + Intronic
1048884925 8:138902249-138902271 AAGGATAAAGGGAAAGGAGAGGG - Intronic
1049058446 8:140257386-140257408 GAGGAGAAGTAGAAGGAAGGTGG - Intronic
1049066437 8:140320047-140320069 AAGGAAAAACCTAAGGAAGAAGG + Intronic
1049311825 8:141937520-141937542 AAGGAGAGAGAAAAGGAAGAAGG - Intergenic
1049547750 8:143241888-143241910 AAAGAGAAAAAGAAGCAAGAAGG + Intergenic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050039744 9:1476626-1476648 AAGGACAAATAAAGGGAAGGTGG + Intergenic
1050267973 9:3911085-3911107 AAGGAAGAAAGGAAGGAAGATGG - Intronic
1050689168 9:8205807-8205829 AAGGATAAATAAAAGGGTGGAGG - Intergenic
1050803642 9:9646617-9646639 TAGTATAAAGAGGAGGAAGAAGG - Intronic
1051188985 9:14491357-14491379 GAGGATAAATAGGATGAATAAGG + Intergenic
1052233866 9:26187820-26187842 AAGGATAAATATCAACAAGATGG + Intergenic
1052636957 9:31118966-31118988 AAAGATAAATAAAAGCAAGTAGG - Intergenic
1052854071 9:33396134-33396156 GAGGATAAAGAGGAAGAAGAGGG + Intronic
1053567295 9:39266864-39266886 AAGGAGCAATACAAGGAAAAAGG + Intronic
1053682085 9:40492298-40492320 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1053833020 9:42104597-42104619 AAGGAGCAATACAAGGAAAAAGG + Intronic
1053932072 9:43120624-43120646 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054129848 9:61352134-61352156 AAGGAGCAATACAAGGAAAAAGG - Intergenic
1054281628 9:63132634-63132656 GAGGATAAAGAGGAAGAAGAGGG - Intergenic
1054295182 9:63327795-63327817 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054393202 9:64632301-64632323 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054427851 9:65137511-65137533 GAGGATAAAGAGGAAGAAGAGGG + Intergenic
1054502525 9:65884027-65884049 GAGGATAAAGAGGAAGAAGAGGG - Intronic
1054597531 9:67082812-67082834 AAGGAGCAATACAAGGAAAAAGG - Intergenic
1055015275 9:71610262-71610284 AGGAGTAAATAGAAGGAAAACGG + Intergenic
1055018549 9:71645078-71645100 AAGGAAAAAAAGAGGGAAGGAGG - Intergenic
1055166308 9:73199622-73199644 AAAGAAAAATGGAAGGAAAAAGG + Intergenic
1055166317 9:73199684-73199706 AAAGAAAAATGGAAGGAAAAAGG + Intergenic
1055371181 9:75601352-75601374 AAGGAGAGAGAGAAGGAAGAAGG - Intergenic
1055540217 9:77296455-77296477 AATGACAGAAAGAAGGAAGAGGG - Intronic
1055722240 9:79188292-79188314 AAGGAGAAAGAGAGGGAAGAGGG - Intergenic
1055752127 9:79518351-79518373 AAGGAAAAGAAGAAGGAAGTTGG - Intergenic
1056069264 9:82968858-82968880 AAGGAAGAAAGGAAGGAAGAAGG + Intergenic
1056089193 9:83187743-83187765 GAGGAGAAATGGAAGGTAGAGGG - Intergenic
1056455877 9:86759342-86759364 AAGGAAAAAAGGAAGGAAGGAGG + Intergenic
1056456754 9:86767869-86767891 AAGGACAAAGAGAGGGAAGAGGG - Intergenic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1056634233 9:88318380-88318402 AAGGATGAAGAGAGGGAAAAAGG + Intergenic
1057169088 9:92950114-92950136 AAGGATAAAAAGAAGCAGGTGGG + Intronic
1057292904 9:93818566-93818588 AAGGAAAGAGGGAAGGAAGAAGG + Intergenic
1057991842 9:99778575-99778597 AAGGATGAACAGAAAGAAAATGG - Intergenic
1058212249 9:102183762-102183784 AGGAATAAATAGAAAGAGGAGGG - Intergenic
1058309095 9:103478588-103478610 TAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1058345008 9:103950821-103950843 AAGGAGGGAAAGAAGGAAGAAGG + Intergenic
1059013088 9:110484127-110484149 ATGGCTAAATAGAAGGACCATGG + Intronic
1059137817 9:111823815-111823837 AAAGAAAAAAAGAAAGAAGAAGG + Intergenic
1059160674 9:112032099-112032121 AAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059203635 9:112442853-112442875 AAGAATAAATAAAAGAAAGCTGG - Intronic
1059355560 9:113696852-113696874 AAGGAGAAATAGAGAGAAGGGGG - Intergenic
1059396255 9:114035817-114035839 AAGGAAAACAAGAAGGAAAAGGG - Intronic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059653717 9:116338190-116338212 AAGAATAAATGGAGGGAGGAGGG - Intronic
1059747527 9:117217478-117217500 AAGGATACAAGGAAGGAAGAAGG - Intronic
1059925122 9:119201908-119201930 AAGGAAAAAAAGAAGAGAGAGGG - Intronic
1060129880 9:121085985-121086007 AAGGAGAACTGGAAGGAAGGTGG + Intronic
1060475916 9:123986514-123986536 AGGGAGGAAGAGAAGGAAGAAGG - Intergenic
1060676982 9:125523961-125523983 AATGGTTATTAGAAGGAAGATGG - Intronic
1060683297 9:125585010-125585032 AAGGTTCTATAGAAGGCAGAAGG + Intronic
1060922599 9:127432709-127432731 AAGAATAAAGATATGGAAGATGG - Intronic
1061232509 9:129322877-129322899 AAGGATAAAAAGGAGGGAGCGGG + Intergenic
1061572889 9:131488561-131488583 AAGAATAAAGAGATGGATGAGGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062257521 9:135635069-135635091 AAGGATAGAAGGAAGGAAGAAGG - Intronic
1062520725 9:136956815-136956837 ATGGATAAATGGATGGATGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1202802051 9_KI270720v1_random:9335-9357 AAGGAAAGATGGAAGGAAGGAGG - Intergenic
1185497532 X:566589-566611 ATGGATAAATGGATGGATGATGG + Intergenic
1185498671 X:580553-580575 AGGGATAAATAGATGATAGATGG + Intergenic
1185498679 X:580688-580710 ATGGATAAATAGATGATAGATGG + Intergenic
1185498683 X:580749-580771 ATGGATAAATAGATGATAGATGG + Intergenic
1185498692 X:580892-580914 ATGGATAAATAGATGATAGACGG + Intergenic
1185498701 X:581035-581057 ATGGATAAATAGATGATAGACGG + Intergenic
1185498708 X:581152-581174 ATGGATAAATAGATGATAGATGG + Intergenic
1185633070 X:1530082-1530104 ATGGATACATAGATGGATGACGG - Intronic
1185726529 X:2426387-2426409 AAGGAAAAAGAGAAGGAAGGAGG - Intronic
1185875711 X:3700563-3700585 AAGAAAAAAGAGAAAGAAGAAGG - Intronic
1186001900 X:5021914-5021936 ATGGATGAATGGATGGAAGATGG - Intergenic
1186020574 X:5251084-5251106 AAGGAAAGAAAGAAGGAAGGAGG + Intergenic
1186047145 X:5548779-5548801 ATGGATGAAGAGGAGGAAGAAGG - Intergenic
1186053684 X:5626793-5626815 AAGGAAGGAAAGAAGGAAGAAGG + Intergenic
1186129016 X:6446324-6446346 AAAGAAAAAAAAAAGGAAGATGG - Intergenic
1186145674 X:6621773-6621795 AAGGAAGAAAGGAAGGAAGAAGG + Intergenic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1186182651 X:6988058-6988080 AAGGATACAATGCAGGAAGAGGG + Intergenic
1186206734 X:7208661-7208683 AAGGAAAAATATAAGGAAGGAGG - Intergenic
1186299835 X:8188194-8188216 AAGGAGAAGGAGTAGGAAGATGG + Intergenic
1186312920 X:8339779-8339801 AAGAAGAAAAAGAAAGAAGAGGG + Intergenic
1186323419 X:8453566-8453588 AAAAAAAAAGAGAAGGAAGAAGG + Intergenic
1186402589 X:9273567-9273589 AAGGATGAAGAAAAGGAAGAAGG + Intergenic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186699206 X:12071242-12071264 AGGGACATATAGGAGGAAGAAGG - Intergenic
1187046592 X:15653494-15653516 GAGGAAAAAGAGGAGGAAGAAGG - Intronic
1187264472 X:17718628-17718650 AAGGAAAAAAGGAAGGAAGAAGG + Intronic
1187264553 X:17718977-17718999 AAGGATGGAGGGAAGGAAGAAGG + Intronic
1187486406 X:19708282-19708304 AGAGTTGAATAGAAGGAAGAGGG + Intronic
1187529753 X:20085668-20085690 AAAGATAAAGAGAAGGAACAGGG + Intronic
1187912098 X:24120524-24120546 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1187912104 X:24120559-24120581 AAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1188326871 X:28815549-28815571 ACAGATAAATAGAAGAAATAAGG - Intronic
1188380190 X:29482124-29482146 AATGATGAGTAGAAGGAACATGG - Intronic
1188421847 X:29999707-29999729 AAGGATAAATGGCATGAACAAGG + Intergenic
1188430152 X:30097291-30097313 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
1188448156 X:30279051-30279073 AAGGAGAAAAAAATGGAAGATGG + Intergenic
1188901750 X:35741276-35741298 AAGGAGAGATAGAGGGAAGGAGG + Intergenic
1188939730 X:36222288-36222310 GAGGATAAATATAAAGGAGAGGG - Intergenic
1189262023 X:39686180-39686202 AAGAAAAAAAAGAAGGAAGGAGG + Intergenic
1189430037 X:40938159-40938181 AAGGATGGAGGGAAGGAAGAAGG + Intergenic
1189649655 X:43175841-43175863 AAGGGAAAAGAGAAAGAAGAGGG + Intergenic
1189869397 X:45366676-45366698 AAATATACATAGAAGCAAGATGG + Intergenic
1190123401 X:47682646-47682668 AAGGAAAGAAAGAAGGAGGAAGG - Intergenic
1190908823 X:54753797-54753819 AGGAATAAATGGAAGGGAGAGGG + Intronic
1191078676 X:56485620-56485642 AAGGCAAAATAGAAGAAAGCAGG - Intergenic
1191612674 X:63133818-63133840 AAGAAAAAACAGGAGGAAGAAGG + Intergenic
1191623623 X:63245108-63245130 AAGAAAAAACAGGAGGAAGAAGG - Intergenic
1191896688 X:66000299-66000321 GAAGAAAAAGAGAAGGAAGAAGG - Intergenic
1192308984 X:69993432-69993454 AAGGATAAATAAAATGACCATGG - Intronic
1192353167 X:70373323-70373345 AAGGAAAGGAAGAAGGAAGAAGG + Intronic
1192890148 X:75381885-75381907 AAGGATAGATGCGAGGAAGAAGG - Intronic
1192924219 X:75738510-75738532 AAGGATAAGGAGAAAGGAGAAGG - Intergenic
1193005397 X:76612797-76612819 AAGGGTAAAGGGGAGGAAGACGG + Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193201607 X:78697941-78697963 TAGGAAAACTAAAAGGAAGAGGG + Intergenic
1193663638 X:84288234-84288256 AATGATCAAAAGAACGAAGAAGG - Intergenic
1193902976 X:87205278-87205300 AAAGAAAAAAAGAAGAAAGAAGG + Intergenic
1193997078 X:88379410-88379432 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
1194036637 X:88883008-88883030 AAGGAAAAATATAAATAAGATGG + Intergenic
1194178222 X:90679221-90679243 AAGGAGAAAGAGAAGGAAAAGGG - Intergenic
1194302539 X:92205517-92205539 TGGGATAAATAGAAGTCAGATGG + Intronic
1194431322 X:93810450-93810472 TAGTATAAATGGAAGGAACATGG - Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194721628 X:97346988-97347010 AAGGAAACAGAGAAGGAAGAAGG - Intronic
1194769648 X:97886049-97886071 AAGGAGAAATAGAGGGGAAAAGG + Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1194975168 X:100387727-100387749 AAGGACAAAAAGAATGAAAAAGG + Intronic
1195699426 X:107691473-107691495 AAGGATGAATAGGTGGAAAATGG - Intergenic
1195944779 X:110198147-110198169 AAGGAAAACGGGAAGGAAGAAGG + Exonic
1196031227 X:111096955-111096977 AAAGAAAAATAAAAGAAAGAGGG - Intronic
1196141102 X:112264674-112264696 AATGAGGAAGAGAAGGAAGATGG - Intergenic
1196458782 X:115908694-115908716 GAGGATGAATAGAAGGCAGAGGG + Intergenic
1196462766 X:115947121-115947143 GAGGATGAATAGAAGGCAGAGGG + Intergenic
1196664481 X:118302304-118302326 AAGGATAAATATAGTTAAGATGG + Intergenic
1196731105 X:118942311-118942333 AAGGAGAAGGAGAAGAAAGAAGG + Intergenic
1197319237 X:125007027-125007049 ATGGATAAATCGAAAGAAGTAGG + Intergenic
1197395834 X:125925864-125925886 ATGGAAAAATAGAAAAAAGAAGG - Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1198019462 X:132644138-132644160 AAGGAAGGAAAGAAGGAAGATGG + Intronic
1198179722 X:134194566-134194588 AAGGAGAAAGAAAAAGAAGAAGG - Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198483650 X:137064862-137064884 AAGGTTAAGCAGTAGGAAGAGGG - Intergenic
1198856508 X:141022770-141022792 AAGGACATAAAGAAAGAAGAAGG + Intergenic
1198906184 X:141564597-141564619 AAGGACATAAAGAAAGAAGAAGG - Intergenic
1198954521 X:142113260-142113282 ATGGATGAATAGATGGAACACGG - Intergenic
1199437271 X:147826855-147826877 AAGTATAATGGGAAGGAAGAGGG - Intergenic
1199628678 X:149761736-149761758 CAGGATCAATGGGAGGAAGAGGG - Intergenic
1199912471 X:152302127-152302149 AAAGATAAATATAAGGATGTGGG + Intronic
1199934117 X:152554303-152554325 AAGGATAGTTTTAAGGAAGAAGG - Intergenic
1200524883 Y:4261372-4261394 AAAGAGAAAGAGAAGGAAAAGGG - Intergenic
1201416704 Y:13754421-13754443 AAAAAAAAAAAGAAGGAAGATGG + Intergenic
1201453008 Y:14136324-14136346 AAGGGAAAAGAGAAGGAAAATGG - Intergenic
1201517668 Y:14835446-14835468 AAGGAAAGAAAGAGGGAAGAGGG + Intronic
1201550371 Y:15211761-15211783 AAGGAAAGAAGGAAGGAAGAAGG + Intergenic
1201578607 Y:15487806-15487828 AAGGAAAAATATAAGGAAGGAGG - Intergenic
1201625635 Y:16011891-16011913 AAGGAAAAAAGGAAGGAAGGAGG + Intergenic
1201625741 Y:16012442-16012464 AAGGAAAAAGGGAAGGAAGGAGG + Intergenic
1201690550 Y:16760135-16760157 AAGGAAAGAAGGAAGGAAGAAGG - Intergenic
1201697389 Y:16840952-16840974 AAGGAAAAATAGAAGGAAGAAGG + Intergenic