ID: 1089241472

View in Genome Browser
Species Human (GRCh38)
Location 11:117084961-117084983
Sequence TTTGTTAACCTGTTGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089241472 Original CRISPR TTTGTTAACCTGTTGATGCA GGG (reversed) Intronic
901074812 1:6547296-6547318 TTTGTTAACCTTGAGATGCCTGG - Intronic
903097438 1:20991088-20991110 TTTGATAATCTGTTAATCCATGG + Intronic
904068064 1:27770695-27770717 TTTATTAACTTGCTGCTGCAAGG - Intergenic
906811494 1:48831566-48831588 TTTTTTAACTTCTTGAAGCAAGG + Intronic
910465856 1:87498962-87498984 TATATTAACCAGTTGAAGCATGG + Intergenic
911330524 1:96520917-96520939 TTTGTTAAAGTGTGGAAGCAGGG + Intergenic
911549425 1:99261857-99261879 TTTGTTGAATTGTTGATGTATGG + Intergenic
916419581 1:164623745-164623767 TTTGTTAACGTGGTAATGAAAGG - Intronic
918336748 1:183523010-183523032 TTTGTTAACCAGTTAAAGCATGG + Intronic
924061100 1:240175210-240175232 TTTGTTTATCTGTTCATTCATGG + Intronic
1065973049 10:30820050-30820072 TCTGTTGACCAGTTGTTGCATGG + Intergenic
1066179177 10:32943007-32943029 TTTTTTAACTTTTTGAGGCAGGG - Intronic
1069265807 10:66455858-66455880 TCTTGTATCCTGTTGATGCAGGG - Intronic
1074177092 10:111018688-111018710 TTAATTAACCTGTTTATGCTGGG + Intergenic
1075341831 10:121652964-121652986 TTTATTCACCTGTTGATTGATGG - Intergenic
1076377985 10:130004283-130004305 TTTGTTAACCAGACGTTGCAAGG + Intergenic
1079199785 11:18366405-18366427 TTTTTTAACTTGCTGATGTAAGG - Exonic
1079395382 11:20057910-20057932 TTTGTAAACCTAATGATTCATGG + Intronic
1079455248 11:20630826-20630848 GTTGTTACCCTGCTGTTGCAGGG + Intronic
1079458009 11:20653354-20653376 CTTGTTAAACTGTAGATGCCAGG - Intronic
1080021812 11:27569447-27569469 TTTGTTTCCTTGTTAATGCAGGG - Intergenic
1081136447 11:39445366-39445388 TTTATTAACCATTTGAGGCAGGG + Intergenic
1085450183 11:76627169-76627191 TTTGTCAACCTGGAGATGCTGGG - Intergenic
1088979686 11:114850921-114850943 TTTATGAAGCTGTTGATCCATGG - Intergenic
1089241472 11:117084961-117084983 TTTGTTAACCTGTTGATGCAGGG - Intronic
1096928472 12:55175840-55175862 TTTTTTAACCCCTTGAAGCATGG - Intergenic
1097514257 12:60584879-60584901 TTTTCTTACCTGTTGCTGCAAGG + Intergenic
1098802109 12:74974149-74974171 TTTCTTCACCTATTGTTGCAGGG + Intergenic
1100183185 12:92107499-92107521 TTTGTTTACCTGTATATACAAGG + Intronic
1107048147 13:36015923-36015945 TTTCTAAACCTGTTTATGCTTGG - Intronic
1110573534 13:77031049-77031071 TTTGTGAACCTTTTGATGGAAGG - Intergenic
1116858689 14:49976343-49976365 TTGGTTAACCTGGTGAGGCTGGG + Intergenic
1119846983 14:77837835-77837857 TTTGTCAACATGTTAATACATGG - Intronic
1119887528 14:78155431-78155453 TCTGTTAACCTATTTATGCCTGG + Intergenic
1122579891 14:102764876-102764898 CTTGTTAAACTGATGAAGCAGGG + Intergenic
1127532425 15:59857513-59857535 TTTTTTTAACTGTAGATGCATGG - Intergenic
1135284516 16:21181906-21181928 TTTGTTTACTTGTTGTAGCAAGG - Intergenic
1144070162 17:11664195-11664217 TTTGTTACCATGGTGATGCTTGG + Intronic
1144090867 17:11855072-11855094 TTTTTTAATCTGTAGAGGCAGGG + Intronic
1152129869 17:78469680-78469702 TTTATGTACCTGTTCATGCATGG - Intronic
1152206075 17:78975122-78975144 TATGTGAACCTGATGTTGCAGGG - Intronic
1152206078 17:78975163-78975185 TATGTGAACCTGATGTTGCAGGG - Intronic
1152206081 17:78975204-78975226 TATGTGAACCTGATGTTGCAGGG - Intronic
1153336052 18:3925928-3925950 TTTGTTTTCCTGTTGAGGTATGG + Intronic
1153336059 18:3925999-3926021 TTTGTTTTCCTGTTGAGGTATGG + Intronic
1157883935 18:51348095-51348117 TTTGTAAACTTATTGATGCAAGG + Intergenic
1158057822 18:53303293-53303315 GTTTTTATCCTGTTGATGGATGG + Intronic
1159505970 18:69336219-69336241 TTTCTTAACCTGCTGTTTCATGG + Intergenic
1160178594 18:76615577-76615599 TTTGTGAACATGTTGATTAAGGG + Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1168164108 19:54534797-54534819 GTTGTTAACTTCTTGAAGCATGG + Intronic
926977399 2:18529044-18529066 TGTGTTAAACTGATGATGCTCGG - Intergenic
927422861 2:22951210-22951232 TTTGTTAACTTGTTTAGGCATGG + Intergenic
927980864 2:27374331-27374353 TTTTTTAACCTGTAGTTGTACGG + Exonic
932748273 2:74353391-74353413 TTTCTTAACCTATTGATACCAGG + Intronic
935922168 2:108027900-108027922 TTTCATAACCTGTTGGTGAATGG - Intergenic
936459334 2:112701097-112701119 TTTCTTAAGCTTCTGATGCAGGG + Intergenic
936531520 2:113279492-113279514 TTTGTTAGCCTGACAATGCAAGG - Intergenic
940964254 2:159820284-159820306 TTTGTTCACTTGTTGATTGATGG - Intronic
942023346 2:171888772-171888794 TTTGTTAAACTTTTGAGCCATGG - Intronic
945619670 2:212119109-212119131 TTTATTTAACAGTTGATGCATGG - Intronic
946520340 2:220457709-220457731 TTTGTTATGCTCTGGATGCATGG + Intergenic
1169980012 20:11373895-11373917 ATTGTCAACCTGCCGATGCATGG + Intergenic
1171185644 20:23122351-23122373 TTCGTTAACATGATGAAGCAAGG + Intergenic
1173433425 20:43011672-43011694 TTTGTTTATCTGTTCATCCATGG - Intronic
1174717007 20:52770435-52770457 TTTTTTAACCTGTTGGTGTGTGG - Intergenic
1177067384 21:16457315-16457337 TTTGTTACCATGTTAAAGCAAGG + Intergenic
1178359616 21:31937679-31937701 TATGTTAACCTTTTAATGTATGG + Intronic
1185113085 22:48913205-48913227 TTTGTTATCCTTTTAATGTATGG + Intergenic
952614405 3:35252334-35252356 TTTTTTAATCTGTTGAAGTATGG - Intergenic
956039089 3:65127335-65127357 TTTTATAACCAGTTGATTCAGGG - Intergenic
960294818 3:115930264-115930286 CTTTTTAACCTGTAGATCCACGG + Intronic
962948667 3:140197960-140197982 TTTGTTATCCTGTGGATCCTGGG + Intronic
963386742 3:144605838-144605860 ATTGTTTCCCTGTTGATGAATGG - Intergenic
963419828 3:145047745-145047767 CTTGTTAACCTGGTGGTGGAAGG + Intergenic
965860081 3:173138032-173138054 TTTGTTAACTTGAAGATGTAAGG - Intronic
966370330 3:179245003-179245025 TTTGTTAAACTGTGGATTCCAGG + Intronic
971119194 4:23685250-23685272 TTTGTTATCCTGTTGAATTAAGG + Intergenic
972449838 4:39185803-39185825 TTTCTTACCCTGTTACTGCAAGG - Exonic
977728165 4:100321584-100321606 TTTCTTTGCCTGTTGATTCAGGG - Intergenic
979528916 4:121747378-121747400 ATTGTTAGCCTGATGCTGCAGGG - Intergenic
981142386 4:141283460-141283482 TTTGTTGATCTGTTTATGAAGGG + Intergenic
982570365 4:157043058-157043080 TTTGTTAACCAGTTGTTGGAGGG + Intergenic
984496787 4:180507907-180507929 TTTGCTAAGATGTTGATACAGGG + Intergenic
988014989 5:25544770-25544792 CTTGTTAACTTGTTGCTGCTGGG + Intergenic
992090177 5:73310105-73310127 TTTGTCAAGCTGTAGAGGCAGGG - Intergenic
993161984 5:84303408-84303430 GTTGTTATCATGTTTATGCATGG - Intronic
993401595 5:87460031-87460053 TTTGTTTACTTGTTGATTGATGG + Intergenic
993435497 5:87888030-87888052 TTTTTTGATCTGTAGATGCATGG + Intergenic
993905452 5:93618598-93618620 TTTTTTAACCTGTTGATTATGGG - Exonic
996598657 5:125235005-125235027 TTGGATAAACTGTTGATGAAAGG + Intergenic
996642625 5:125775691-125775713 TTTGTTACCCTGTTGCTCCTAGG + Intergenic
1000121525 5:158202519-158202541 TTTGTTCACATTTTGATGCATGG - Intergenic
1001209726 5:169798998-169799020 TTTGATAAACTCTTGAAGCAAGG - Intronic
1003353417 6:5342229-5342251 TTTGTTCATCAGCTGATGCATGG - Intronic
1003967316 6:11265107-11265129 TTTTTTAATCTGTTAATTCAAGG + Intronic
1007666715 6:43517970-43517992 TTTTTTAACCTGTTGATACAAGG + Intronic
1009640252 6:66326349-66326371 TTTGTTTACCTAATGAGGCATGG - Intergenic
1010842892 6:80669603-80669625 TATTTTAATCTGATGATGCAAGG + Intergenic
1011444657 6:87424730-87424752 TTTCTTAATCTATTGATACAAGG - Intronic
1015573743 6:134648922-134648944 TTTGTGATCTTGTTGATGCCAGG + Intergenic
1016786744 6:148019076-148019098 TTTGTTAACTTGTTTATTCAAGG + Intergenic
1017618044 6:156265876-156265898 TTTGTTAACATGCAGATGGAGGG + Intergenic
1017630798 6:156394867-156394889 TTTTTTTACCTGTTAAAGCATGG + Intergenic
1020582336 7:10019054-10019076 TTTTTTAACATGTTGATGTCTGG - Intergenic
1022502472 7:30891390-30891412 TTTTTTAACCTGAAGAAGCACGG - Intronic
1029878399 7:103779114-103779136 TTTGGAAAACTGCTGATGCAAGG - Intronic
1030453547 7:109744228-109744250 TTTGTTAACCTGTTGGGCAATGG + Intergenic
1034315801 7:150131817-150131839 TTTCTTTATCTGTTGATCCATGG - Intergenic
1036648570 8:10627243-10627265 TTTGTTAATCTGTTCATCCGCGG - Intronic
1037178410 8:15974105-15974127 TTTAATAACTTGTTGATGTAGGG - Intergenic
1037852268 8:22341216-22341238 TTCTTTAGCCTGTTGATGGATGG - Intronic
1040998163 8:53422582-53422604 CTTGTTAACCTTTTGTTACAGGG + Intergenic
1041142493 8:54837571-54837593 TTTGTTTACCTGTTGATTCCTGG + Intergenic
1041337401 8:56801981-56802003 TTTGTGAACCAGTTGATGTTAGG + Intergenic
1044171563 8:89059324-89059346 TTTACTAAGCTGCTGATGCAAGG + Intergenic
1044973235 8:97640022-97640044 TTTGTAAATGTGTTGCTGCAAGG - Intergenic
1047595626 8:126374994-126375016 TCTGGTACCCTGTTGATGCTGGG - Intergenic
1048957001 8:139545455-139545477 TTTGTTATCCTGTTGAAAAAGGG - Intergenic
1049112487 8:140656194-140656216 CCTGTTCACCTGTTGATGAATGG - Intergenic
1052155551 9:25184377-25184399 TTTATTTACCTGTCGATGAATGG + Intergenic
1055778881 9:79797201-79797223 TTTGTTAGCATTTTGGTGCATGG + Intergenic
1058499765 9:105600836-105600858 TTTCTTATCCTTTTGATGTATGG + Intronic
1060578142 9:124717335-124717357 TTTATTTACCTGTTGATACCTGG - Intronic
1061531458 9:131216837-131216859 TTTGTTGACCTGTGTATTCATGG + Intronic
1061919285 9:133773531-133773553 TTTGTTAACTTTTTGAAGCTTGG + Intronic
1190081880 X:47363077-47363099 TTTATTAACCTGCTGCGGCAAGG + Intergenic
1191687971 X:63912222-63912244 TGTATTAACCTGTTGATGAGAGG - Intergenic
1193329115 X:80216075-80216097 GTTGTTAACCTGCTGAGGAATGG + Intergenic
1193429085 X:81378042-81378064 CCTGTTAACATGTTGATGCAGGG + Intergenic
1193763662 X:85498137-85498159 TTTTTAAACCTGTCTATGCATGG + Intergenic
1196406218 X:115365478-115365500 TTAGACAAACTGTTGATGCAGGG + Intergenic
1196702274 X:118683769-118683791 TTTGTTTTCCTTTTGAAGCATGG + Intronic