ID: 1089243131

View in Genome Browser
Species Human (GRCh38)
Location 11:117098440-117098462
Sequence GGCCGCGGGGAGCCGGCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 263}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089243116_1089243131 14 Left 1089243116 11:117098403-117098425 CCGCCGCCGCCATCTTGTTGTGC 0: 1
1: 0
2: 1
3: 19
4: 81
Right 1089243131 11:117098440-117098462 GGCCGCGGGGAGCCGGCTCGGGG 0: 1
1: 0
2: 2
3: 22
4: 263
1089243117_1089243131 11 Left 1089243117 11:117098406-117098428 CCGCCGCCATCTTGTTGTGCAGT 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1089243131 11:117098440-117098462 GGCCGCGGGGAGCCGGCTCGGGG 0: 1
1: 0
2: 2
3: 22
4: 263
1089243114_1089243131 24 Left 1089243114 11:117098393-117098415 CCGCTCGCCGCCGCCGCCGCCAT 0: 1
1: 1
2: 30
3: 249
4: 986
Right 1089243131 11:117098440-117098462 GGCCGCGGGGAGCCGGCTCGGGG 0: 1
1: 0
2: 2
3: 22
4: 263
1089243115_1089243131 17 Left 1089243115 11:117098400-117098422 CCGCCGCCGCCGCCATCTTGTTG 0: 1
1: 1
2: 7
3: 52
4: 211
Right 1089243131 11:117098440-117098462 GGCCGCGGGGAGCCGGCTCGGGG 0: 1
1: 0
2: 2
3: 22
4: 263
1089243113_1089243131 30 Left 1089243113 11:117098387-117098409 CCAGCTCCGCTCGCCGCCGCCGC 0: 1
1: 1
2: 33
3: 151
4: 837
Right 1089243131 11:117098440-117098462 GGCCGCGGGGAGCCGGCTCGGGG 0: 1
1: 0
2: 2
3: 22
4: 263
1089243119_1089243131 5 Left 1089243119 11:117098412-117098434 CCATCTTGTTGTGCAGTGAAACC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1089243131 11:117098440-117098462 GGCCGCGGGGAGCCGGCTCGGGG 0: 1
1: 0
2: 2
3: 22
4: 263
1089243118_1089243131 8 Left 1089243118 11:117098409-117098431 CCGCCATCTTGTTGTGCAGTGAA 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1089243131 11:117098440-117098462 GGCCGCGGGGAGCCGGCTCGGGG 0: 1
1: 0
2: 2
3: 22
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089243131 Original CRISPR GGCCGCGGGGAGCCGGCTCG GGG Intergenic