ID: 1089248017

View in Genome Browser
Species Human (GRCh38)
Location 11:117136745-117136767
Sequence TTCACGGATGGGCACACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089248017_1089248023 30 Left 1089248017 11:117136745-117136767 CCAAGAGTGTGCCCATCCGTGAA No data
Right 1089248023 11:117136798-117136820 ATACTACCTCTCATATTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089248017 Original CRISPR TTCACGGATGGGCACACTCT TGG (reversed) Intergenic
No off target data available for this crispr