ID: 1089248023

View in Genome Browser
Species Human (GRCh38)
Location 11:117136798-117136820
Sequence ATACTACCTCTCATATTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089248022_1089248023 14 Left 1089248022 11:117136761-117136783 CCGTGAAATGGGCATTGCTCTCT No data
Right 1089248023 11:117136798-117136820 ATACTACCTCTCATATTCCCTGG No data
1089248020_1089248023 19 Left 1089248020 11:117136756-117136778 CCCATCCGTGAAATGGGCATTGC No data
Right 1089248023 11:117136798-117136820 ATACTACCTCTCATATTCCCTGG No data
1089248021_1089248023 18 Left 1089248021 11:117136757-117136779 CCATCCGTGAAATGGGCATTGCT No data
Right 1089248023 11:117136798-117136820 ATACTACCTCTCATATTCCCTGG No data
1089248017_1089248023 30 Left 1089248017 11:117136745-117136767 CCAAGAGTGTGCCCATCCGTGAA No data
Right 1089248023 11:117136798-117136820 ATACTACCTCTCATATTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089248023 Original CRISPR ATACTACCTCTCATATTCCC TGG Intergenic
No off target data available for this crispr