ID: 1089248252

View in Genome Browser
Species Human (GRCh38)
Location 11:117137978-117138000
Sequence CAGGGTGACCTGCGGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089248246_1089248252 11 Left 1089248246 11:117137944-117137966 CCTGTCTGGGGGATGGAGTTCTT No data
Right 1089248252 11:117137978-117138000 CAGGGTGACCTGCGGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089248252 Original CRISPR CAGGGTGACCTGCGGGGTGA AGG Intergenic
No off target data available for this crispr