ID: 1089254487

View in Genome Browser
Species Human (GRCh38)
Location 11:117187070-117187092
Sequence CTGTCTGGAGGGCTCGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089254479_1089254487 9 Left 1089254479 11:117187038-117187060 CCAGAGTAGGGGAGGGAGGGTGC 0: 1
1: 0
2: 2
3: 44
4: 328
Right 1089254487 11:117187070-117187092 CTGTCTGGAGGGCTCGTGGGCGG 0: 1
1: 0
2: 1
3: 9
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089254487 Original CRISPR CTGTCTGGAGGGCTCGTGGG CGG Intronic
900095347 1:937937-937959 CTGACGGCAGGGCTTGTGGGGGG + Intronic
901269710 1:7942385-7942407 CTGTCGGGAGAGCTCGTGCTGGG - Intronic
901859282 1:12063835-12063857 CTGGCTGAAGGGCTAGTGGTGGG + Intronic
902657236 1:17877641-17877663 CAGTCTGGAGGGCCTCTGGGAGG - Intergenic
902798464 1:18814790-18814812 GGGTCTGGAGGGCTGATGGGGGG - Intergenic
903847280 1:26285823-26285845 CTGTGTGGAGGGATCGTAGAAGG + Exonic
904910221 1:33929098-33929120 TTTCCTGGAGGGCTGGTGGGTGG - Intronic
908061705 1:60356994-60357016 CTGGCTGGAGGGCTGTTGTGTGG - Intergenic
908484388 1:64576287-64576309 CTGTCTGCAGGGATCATGGCAGG + Intronic
910317013 1:85897245-85897267 CTGTCAGGGGGCCTCGGGGGAGG + Intronic
915510031 1:156381827-156381849 CTGGCTGGAGGGGTTGTGGTGGG + Exonic
917646165 1:177030773-177030795 CTGACATTAGGGCTCGTGGGTGG - Intronic
918821385 1:189259892-189259914 CTTTCTGGAGGGCTGGTGTGGGG + Intergenic
920534963 1:206731428-206731450 CTGTGTGGAGGGCTGGAGGCAGG + Intronic
920575745 1:207059128-207059150 GTTGCTGGAGGGCTCTTGGGAGG + Intronic
922915416 1:229253204-229253226 CTGCCTGGAGGGCGAGAGGGCGG - Intergenic
924568203 1:245215269-245215291 CTGGCTGGAGGGCACCTGGCTGG - Intronic
1063101151 10:2951173-2951195 CTTTCTGAAGGGCGCATGGGAGG - Intergenic
1063929043 10:11010669-11010691 CTGTCAAGATGGCTCATGGGAGG - Intronic
1066046948 10:31603102-31603124 CTGGCTTGAGGGGTCGTGGTGGG - Intergenic
1067045339 10:42982140-42982162 GTGTGTGGTTGGCTCGTGGGTGG - Intergenic
1071407415 10:85351493-85351515 GTGTCTGGAGGCCTGGAGGGTGG + Intergenic
1071521989 10:86337242-86337264 GTGGCCGGTGGGCTCGTGGGGGG - Intronic
1073011112 10:100360378-100360400 CTGTCTGGGAGCCTTGTGGGAGG - Intronic
1073582417 10:104680762-104680784 TTCTCTGGAGGGCTCTTGTGAGG + Intronic
1076510505 10:131011084-131011106 CTGCCGGGAGGCCTCCTGGGAGG + Intergenic
1076779515 10:132716515-132716537 CTGTCTGGAGAGCGTTTGGGTGG + Intronic
1083203799 11:61135362-61135384 TTGTCTGGAGGGCTCAGGGAGGG - Intronic
1083326792 11:61877011-61877033 AGGTCTGGAGGCCTGGTGGGTGG + Intronic
1083488943 11:63000735-63000757 CTGATTGGAGGGCTCGTGCTTGG - Exonic
1083519159 11:63291594-63291616 CTGACTGGAATGCTGGTGGGAGG + Exonic
1088790630 11:113223187-113223209 TTGTCTGGATGGCTGGTAGGTGG + Intronic
1089119728 11:116125083-116125105 CTGTCAGGAGGGCTGCTGTGGGG - Intergenic
1089254487 11:117187070-117187092 CTGTCTGGAGGGCTCGTGGGCGG + Intronic
1092198830 12:6567367-6567389 CTGTGTGGAAGACTGGTGGGAGG - Intronic
1096033496 12:48442514-48442536 CTGTGTTCAGGGCTGGTGGGGGG - Intergenic
1104775076 12:131386058-131386080 CTGCCTGGAGAGCCCGGGGGTGG + Intergenic
1104919101 12:132281318-132281340 CTGTGGGCAGGGCTCGTGAGGGG + Intronic
1104970618 12:132529099-132529121 CGGCCTGCTGGGCTCGTGGGAGG + Intronic
1106415443 13:29542643-29542665 CTGTCTGGAGTGCTGGAGTGCGG - Intronic
1107834865 13:44404951-44404973 CTGGCTGGGGGGCTGGGGGGAGG + Intergenic
1108191895 13:47950286-47950308 ATTTCTGGAGGGCTAGTGTGGGG + Intronic
1112434280 13:99380430-99380452 TTGTCTGTAGGGCTCTTTGGTGG - Intronic
1113888670 13:113725174-113725196 CTGCGTGGGGGGCGCGTGGGAGG - Intronic
1116614136 14:47112394-47112416 CTGTCTTGAGGGGTAGAGGGAGG - Intronic
1117546572 14:56798323-56798345 CTGACTGCAGGGCTCGGGCGGGG + Intergenic
1118063413 14:62165202-62165224 CTGTGTGGAGGGCTGCTGTGAGG + Intergenic
1118162288 14:63302211-63302233 CGGTCTGGGGGGCTGTTGGGTGG + Intergenic
1119330442 14:73789458-73789480 CTGCCTGAAGGGCCCGAGGGAGG - Intronic
1122183596 14:99972266-99972288 GGGTCTGCAGGGCTTGTGGGGGG + Intronic
1122296466 14:100708979-100709001 CTGGCTGGAGGGCGCACGGGAGG - Intergenic
1122939219 14:104973773-104973795 CTCTCTGCAGAGCTCTTGGGAGG - Intronic
1122939758 14:104976045-104976067 CTTTCTTGGGGGGTCGTGGGAGG + Intronic
1123039845 14:105486024-105486046 CTGACAGGAGGGATGGTGGGTGG + Intergenic
1125131839 15:36290925-36290947 CTGTCGGGAGGGGAGGTGGGGGG + Intergenic
1125589250 15:40844327-40844349 GTCCCTGGAGGGCGCGTGGGAGG + Intronic
1129372479 15:75106206-75106228 GTGGCCAGAGGGCTCGTGGGTGG + Intronic
1129739967 15:77985387-77985409 CTTCCTGGAGCCCTCGTGGGTGG + Intronic
1130769615 15:86911368-86911390 CACCCTTGAGGGCTCGTGGGTGG - Intronic
1130832603 15:87616744-87616766 CTGTCTGGAGGGCTGATGGGTGG + Intergenic
1131176648 15:90213464-90213486 ATGGCTGGAGGGCTTGTGGCTGG + Intronic
1131458096 15:92598830-92598852 CTGTCTGCAAGGCCCCTGGGGGG + Intergenic
1131622486 15:94082320-94082342 CACTCTGGAGGGCTCTTTGGAGG + Intergenic
1132019281 15:98346414-98346436 GTGTCTGATGGGCTCGGGGGAGG - Intergenic
1132665790 16:1080787-1080809 CTGTCTGGAGGGGTCCAGTGTGG + Intergenic
1132673993 16:1114187-1114209 GTGTCCGGAGGGCTGGTGAGTGG - Intergenic
1132937321 16:2487772-2487794 GTGTCTCCAGGACTCGTGGGAGG + Intronic
1135300968 16:21326851-21326873 CTGTATGTAGGGATCCTGGGTGG - Intergenic
1136077355 16:27826320-27826342 CTGTCTGTGGGGCCCTTGGGAGG - Intronic
1136169159 16:28477777-28477799 CTGTATGAGGGGCTCCTGGGAGG - Exonic
1136276202 16:29180705-29180727 CTGTCTGAAGGGCCTGCGGGAGG + Intergenic
1136550531 16:30980232-30980254 GTGCCTGGAGGGGTCGGGGGAGG - Intronic
1137247493 16:46717595-46717617 CTGCCTGGAGGGGAGGTGGGGGG - Intronic
1137673003 16:50290449-50290471 GTGTCTGGAGGGGTCCTGGGTGG - Exonic
1137804266 16:51288629-51288651 CTGGCTGGAAGGCTGGTGGAAGG - Intergenic
1138334267 16:56240220-56240242 GTGTGTGGAGGGCTCGGGAGTGG + Intronic
1138492023 16:57382497-57382519 CTGGGTGGAGGGGTCCTGGGTGG - Exonic
1138708277 16:58940077-58940099 ATGTCTGGAGAGCTCATGTGGGG + Intergenic
1141555956 16:84836882-84836904 CTGTCTGGAGGGTTGGGTGGTGG - Intronic
1141557207 16:84844075-84844097 CTGTCGGGAGGACTCCAGGGAGG + Intronic
1141717575 16:85735622-85735644 CTGCCAGCAGGGCTCGGGGGTGG + Intronic
1142080581 16:88146764-88146786 CTGTCTGAAGGGCCTGCGGGAGG + Intergenic
1142755327 17:2013305-2013327 CTGCCAGGAGGGCTAGTGGCAGG + Intronic
1143563773 17:7709538-7709560 ATGTTTGGAGGGCTCTGGGGGGG - Exonic
1143683471 17:8494914-8494936 GTGTCTGGCAGGCACGTGGGTGG - Intronic
1144762264 17:17714024-17714046 CTGGGTGGAGGCATCGTGGGCGG - Intronic
1145911451 17:28545829-28545851 CTGTGTGGAGGGTTCTGGGGAGG - Intronic
1146974518 17:37099435-37099457 CTGCCTGGAGGGCTGATGGCGGG + Intronic
1147917582 17:43898046-43898068 CTGTCTGGTGAGTGCGTGGGTGG - Intronic
1148212494 17:45817022-45817044 CTGGCTGGAGGGCCCGGGGTAGG - Intronic
1148821105 17:50360194-50360216 CAGTCTGCAGGGCTCCAGGGAGG - Exonic
1150490921 17:65573699-65573721 CTGTCTGGTGGGTTGTTGGGAGG + Intronic
1151882707 17:76904627-76904649 CTGTTTGCAGGGCAGGTGGGGGG + Intronic
1151943348 17:77306160-77306182 CTTTCTGGAGGGTTCCAGGGAGG + Intronic
1152838181 17:82548933-82548955 CTCTCTGGAGGTCTCACGGGTGG - Intronic
1154216629 18:12420699-12420721 CGGGCTGGGGGGCTGGTGGGAGG + Intronic
1157480446 18:48050392-48050414 CTGCCTGGGGTGCTCGTGGCGGG - Intronic
1157618485 18:49001847-49001869 CTATCTTGAGGGCTGGTGTGAGG + Intergenic
1158844641 18:61428849-61428871 ATGGCTGGAGGGCTGGTGGGTGG - Intronic
1161545509 19:4878048-4878070 CTGCCTGCAGGACTTGTGGGAGG - Intergenic
1161990461 19:7681447-7681469 CTTTCTGGAGAGCACGGGGGTGG + Intronic
1162002645 19:7757002-7757024 CTGTTTGGAGGGCTCAGAGGAGG + Intergenic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162798804 19:13099888-13099910 TTGTCTGGATGGCTCTTGGGAGG - Intronic
1163491679 19:17620532-17620554 CTGTCTGGCTTGCTCGTGGGGGG - Intronic
1163822682 19:19505286-19505308 TCGTCAGGAGGGCTCCTGGGAGG - Intronic
1165694970 19:37894147-37894169 CTGTCTGGAGGGATTTTTGGTGG - Exonic
1166877128 19:45904049-45904071 CTGTGTGGAGGGTGGGTGGGAGG + Intergenic
1167237714 19:48325227-48325249 CTGTCTGGAGGGATTGGGTGGGG + Intronic
1167272031 19:48511326-48511348 CTGTCAGCAGGGCCTGTGGGAGG - Intronic
925144200 2:1570073-1570095 CTGTGTGGTGGCCTCGTGGAAGG + Intergenic
925383987 2:3449168-3449190 CAGCCTGCAGGGCGCGTGGGAGG - Intronic
926142219 2:10374545-10374567 CTGTCTGCAGGGCCCATGCGGGG + Intronic
926951892 2:18252254-18252276 CTGACTGCAGGGCTTTTGGGGGG + Intronic
929562136 2:42962526-42962548 CTGGCTGGAGGGGTTGGGGGAGG + Intergenic
931676610 2:64702662-64702684 CTGGGTGGAGGGCTTGCGGGAGG + Intronic
931869817 2:66445631-66445653 CTGTCTCTAGGGCCCGTTGGCGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934985808 2:98883929-98883951 CTGTCTGGAGGTGGTGTGGGTGG - Intronic
935582479 2:104768879-104768901 CTTTCTGGAGAGGTCGTGAGTGG - Intergenic
935593638 2:104863401-104863423 CTTTCTGCAGGGCTTGTGGAAGG + Intergenic
937977513 2:127590651-127590673 CTGTCTGCAGGGCTGGTGAAAGG - Intronic
937982737 2:127624717-127624739 CTGACTGGGGGGCTCGGGAGGGG + Intronic
938422385 2:131155412-131155434 CTGTCAGGAGGGGTCTGGGGAGG - Intronic
944414181 2:199467122-199467144 CTGACTTGAGGTCTCTTGGGAGG - Intronic
946187602 2:217989866-217989888 CTGTGTGGAGGGTTTGTGGCAGG - Intronic
948609645 2:239158720-239158742 GTGTCTGGAGGGCGGGTGCGCGG - Intronic
1169039576 20:2482038-2482060 CTGTGGGCAGGGCTTGTGGGTGG - Exonic
1172940430 20:38650174-38650196 CTCTCTGGAGGGCTGGAGGGTGG - Exonic
1178744979 21:35240297-35240319 CTGTCAGGAGGTCAGGTGGGGGG + Intronic
1179242097 21:39601706-39601728 CTGTCAGCACGGCTGGTGGGAGG + Intronic
1179959171 21:44758709-44758731 TTGTCTGGAGGGCACATGGAGGG + Intergenic
1181166947 22:20988997-20989019 CTGTCTGGGGGTTTCTTGGGAGG + Intronic
1182764252 22:32747012-32747034 CTGGCTGGAGGGAGCCTGGGTGG + Intronic
1183319659 22:37157266-37157288 CTGTCTTGGGGACTGGTGGGTGG - Intronic
1184161759 22:42701238-42701260 CTGTCTTGTGGGCACGTGGCAGG - Intronic
1185052935 22:48563197-48563219 TTGTCTGCAGGGCTCTTGGAGGG - Intronic
1185181422 22:49365642-49365664 CAGCCTGGAGGGCTGGTGGACGG + Intergenic
950566470 3:13772489-13772511 CTGGCAGGAGGGCTTGTCGGGGG + Intergenic
952000285 3:28777370-28777392 GTGACTGGAGGGCTGGTGGAGGG + Intergenic
952074636 3:29681500-29681522 CTGTCTGGGGGGATTGTGTGGGG - Intronic
953878929 3:46681684-46681706 TTGTCTGGAAGGCTCCTTGGGGG - Intronic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
954297773 3:49683749-49683771 ATGTCTGGAGGACTAGTGTGAGG + Exonic
961516381 3:127439980-127440002 CTGACTGAAGGGATCATGGGTGG - Intergenic
964335390 3:155649092-155649114 CAGTCTGGAGGGCAAGAGGGGGG + Intronic
968224783 3:196966898-196966920 TCGTCGGGAGGGCTCGTGAGCGG + Intronic
973346566 4:49062550-49062572 CAGTCTGGGAGGCTGGTGGGAGG - Intergenic
976609947 4:87019870-87019892 GTGTCTGAAGGGGTCGGGGGGGG + Intronic
979758869 4:124374632-124374654 CTGTCTGGAGGCCTCCGGGCTGG + Intergenic
983683940 4:170385386-170385408 CTGACTGGAGAGCCCTTGGGTGG - Intergenic
985524475 5:395018-395040 CTGTCTCGAGGCATCTTGGGAGG + Intronic
985876842 5:2606414-2606436 CTGTTTGGAGGGCTCCTTGGTGG - Intergenic
992263145 5:74990623-74990645 CAGTCTGGATGGCACGTTGGTGG + Intergenic
992978662 5:82142661-82142683 CAGTGTGGAGGGTGCGTGGGAGG + Intronic
998697188 5:144653561-144653583 CAGTCTGGAGGGCTCGGAAGAGG - Intergenic
999343747 5:150796437-150796459 CTGGCTGCAGAGCTGGTGGGAGG - Exonic
1001576144 5:172765273-172765295 CTTTCTGGAGAGCAGGTGGGAGG - Intergenic
1001602024 5:172935093-172935115 CTTTCTGGAGGGTTGCTGGGGGG + Intronic
1001775945 5:174329160-174329182 CTGTCGGGAGAGCTCCTGCGAGG + Intergenic
1005851927 6:29828745-29828767 CTACCTGGAGGGCACGTGCGTGG + Exonic
1005864469 6:29927380-29927402 CTACCTGGAGGGCACGTGCGTGG + Intergenic
1006043061 6:31271124-31271146 CTACCTGGAGGGCACGTGCGTGG - Exonic
1006393324 6:33771625-33771647 CTGGCGGGAGGGCCGGTGGGCGG + Exonic
1007430343 6:41772804-41772826 GTGGCTGGGGGGCTCGAGGGAGG + Exonic
1007708355 6:43805365-43805387 CTGTCTGCAGGGCCCTGGGGAGG - Intergenic
1008213985 6:48762133-48762155 TTGTGTGGAGGGCTCATGTGTGG - Intergenic
1017376503 6:153775812-153775834 CAGGCTGGAGTGCACGTGGGCGG + Intergenic
1017751208 6:157492083-157492105 CTGCCTGGAGGGCTGCTGGATGG - Intronic
1018033989 6:159866474-159866496 CTGCCTGGAAGGCCAGTGGGGGG + Intergenic
1019329538 7:455734-455756 CTGCCTGGTGGGCATGTGGGCGG - Intergenic
1020118332 7:5488677-5488699 CTGGCTGGAGGGCCTGTGAGTGG + Intronic
1028621927 7:92835396-92835418 CCGTCTGGGGGGCGAGTGGGGGG - Intronic
1031997158 7:128240622-128240644 CTCTCTGGAGGGCTCCAGGCGGG - Intergenic
1035636068 8:1145273-1145295 CTTCCTGGAGGGATGGTGGGTGG - Intergenic
1040008667 8:42642695-42642717 TTGACTGGAAGGCTCATGGGAGG - Intergenic
1045102389 8:98858561-98858583 CTGGCTGAAGGGATAGTGGGAGG + Intronic
1047740247 8:127800906-127800928 GTGTCTGGAGGGCTGGGGCGTGG + Intergenic
1049153999 8:141055962-141055984 CTCTCTGGAGCGCCAGTGGGGGG - Intergenic
1049326149 8:142022495-142022517 CTGTCTGGAGGGGTAGGGAGTGG + Intergenic
1049719431 8:144108787-144108809 CTGCCTGTTGGGCTCGGGGGCGG - Exonic
1056125958 9:83537201-83537223 CTGTCAGGAGAGCTAGTGTGAGG - Intronic
1057817164 9:98304221-98304243 CGGTCTGGAGGGATGGTGGGGGG + Intronic
1058421131 9:104834631-104834653 CTCTCTGGGGTGCTCGTGAGGGG + Intronic
1059416534 9:114166057-114166079 CTGGCTGGATGGATGGTGGGTGG - Intronic
1060047762 9:120354099-120354121 CTGTGGGGAAGGCTCTTGGGAGG - Intergenic
1060241335 9:121906376-121906398 CTGCCTGGAGGGATCAGGGGAGG - Intronic
1062001490 9:134218092-134218114 GTGTCTGGAGGGCTGGAGAGGGG + Intergenic
1187950596 X:24466224-24466246 CTGTCCGGTGGGCTGGTGGGCGG + Intronic
1188171968 X:26938589-26938611 CTGTTTGGAGGGCTGGGGGTGGG + Intergenic
1190819569 X:53960868-53960890 CTGGGTGGCGGACTCGTGGGTGG + Intronic
1192799478 X:74452113-74452135 CAGTCTGGAGGGCGCCTTGGGGG - Intronic
1196515654 X:116606955-116606977 CTGTCTGGAGGCTCTGTGGGAGG + Intergenic