ID: 1089256873

View in Genome Browser
Species Human (GRCh38)
Location 11:117198895-117198917
Sequence CTTTTAGCTCTGATGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089256873_1089256880 -4 Left 1089256873 11:117198895-117198917 CCATGTCCCATCAGAGCTAAAAG No data
Right 1089256880 11:117198914-117198936 AAAGCCCCAGGAGGAGAGGGTGG No data
1089256873_1089256885 21 Left 1089256873 11:117198895-117198917 CCATGTCCCATCAGAGCTAAAAG No data
Right 1089256885 11:117198939-117198961 GGTTTGTCCCCACAAACCCCTGG No data
1089256873_1089256882 0 Left 1089256873 11:117198895-117198917 CCATGTCCCATCAGAGCTAAAAG No data
Right 1089256882 11:117198918-117198940 CCCCAGGAGGAGAGGGTGGCTGG No data
1089256873_1089256879 -7 Left 1089256873 11:117198895-117198917 CCATGTCCCATCAGAGCTAAAAG No data
Right 1089256879 11:117198911-117198933 CTAAAAGCCCCAGGAGGAGAGGG No data
1089256873_1089256886 22 Left 1089256873 11:117198895-117198917 CCATGTCCCATCAGAGCTAAAAG No data
Right 1089256886 11:117198940-117198962 GTTTGTCCCCACAAACCCCTGGG No data
1089256873_1089256890 30 Left 1089256873 11:117198895-117198917 CCATGTCCCATCAGAGCTAAAAG No data
Right 1089256890 11:117198948-117198970 CCACAAACCCCTGGGATTCCCGG No data
1089256873_1089256878 -8 Left 1089256873 11:117198895-117198917 CCATGTCCCATCAGAGCTAAAAG No data
Right 1089256878 11:117198910-117198932 GCTAAAAGCCCCAGGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089256873 Original CRISPR CTTTTAGCTCTGATGGGACA TGG (reversed) Intergenic
No off target data available for this crispr