ID: 1089257049

View in Genome Browser
Species Human (GRCh38)
Location 11:117199560-117199582
Sequence GGGCCCCCATGCTGACTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089257049_1089257053 -5 Left 1089257049 11:117199560-117199582 CCTCTCAGTCAGCATGGGGGCCC 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1089257053 11:117199578-117199600 GGCCCAAGCTCCAGGCAGGGTGG 0: 1
1: 0
2: 2
3: 40
4: 355
1089257049_1089257059 16 Left 1089257049 11:117199560-117199582 CCTCTCAGTCAGCATGGGGGCCC 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1089257059 11:117199599-117199621 GGGCTGGATCACTAGCGTCCTGG 0: 1
1: 0
2: 0
3: 31
4: 739
1089257049_1089257052 -8 Left 1089257049 11:117199560-117199582 CCTCTCAGTCAGCATGGGGGCCC 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1089257052 11:117199575-117199597 GGGGGCCCAAGCTCCAGGCAGGG 0: 1
1: 0
2: 6
3: 34
4: 262
1089257049_1089257051 -9 Left 1089257049 11:117199560-117199582 CCTCTCAGTCAGCATGGGGGCCC 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1089257051 11:117199574-117199596 TGGGGGCCCAAGCTCCAGGCAGG 0: 1
1: 0
2: 2
3: 33
4: 311
1089257049_1089257054 -4 Left 1089257049 11:117199560-117199582 CCTCTCAGTCAGCATGGGGGCCC 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1089257054 11:117199579-117199601 GCCCAAGCTCCAGGCAGGGTGGG 0: 1
1: 1
2: 4
3: 26
4: 360
1089257049_1089257057 0 Left 1089257049 11:117199560-117199582 CCTCTCAGTCAGCATGGGGGCCC 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1089257057 11:117199583-117199605 AAGCTCCAGGCAGGGTGGGCTGG 0: 1
1: 0
2: 3
3: 67
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089257049 Original CRISPR GGGCCCCCATGCTGACTGAG AGG (reversed) Intronic