ID: 1089257334

View in Genome Browser
Species Human (GRCh38)
Location 11:117200793-117200815
Sequence TACCCCCAGCTTCCAGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089257334_1089257342 22 Left 1089257334 11:117200793-117200815 CCTGAGACTGGAAGCTGGGGGTA 0: 1
1: 0
2: 2
3: 19
4: 262
Right 1089257342 11:117200838-117200860 CTGTTCCTCAGGAGCCCAGCAGG 0: 1
1: 0
2: 2
3: 32
4: 257
1089257334_1089257343 23 Left 1089257334 11:117200793-117200815 CCTGAGACTGGAAGCTGGGGGTA 0: 1
1: 0
2: 2
3: 19
4: 262
Right 1089257343 11:117200839-117200861 TGTTCCTCAGGAGCCCAGCAGGG 0: 1
1: 0
2: 2
3: 27
4: 273
1089257334_1089257338 11 Left 1089257334 11:117200793-117200815 CCTGAGACTGGAAGCTGGGGGTA 0: 1
1: 0
2: 2
3: 19
4: 262
Right 1089257338 11:117200827-117200849 CTCCTTCCATCCTGTTCCTCAGG 0: 1
1: 0
2: 2
3: 44
4: 405
1089257334_1089257344 24 Left 1089257334 11:117200793-117200815 CCTGAGACTGGAAGCTGGGGGTA 0: 1
1: 0
2: 2
3: 19
4: 262
Right 1089257344 11:117200840-117200862 GTTCCTCAGGAGCCCAGCAGGGG 0: 1
1: 0
2: 2
3: 23
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089257334 Original CRISPR TACCCCCAGCTTCCAGTCTC AGG (reversed) Intronic
901857546 1:12054045-12054067 GACCCCAAGCTTTCAGACTCTGG - Intergenic
901879549 1:12185839-12185861 AACCCCCAGCCTGCAGCCTCAGG + Intronic
902797318 1:18808057-18808079 TCCCCCCAGCCTCCATTCACAGG + Intergenic
903051332 1:20603445-20603467 CACCTCCACCTTCCAGTCTGTGG + Intronic
904239645 1:29135400-29135422 TACCTTCTGCTTCCAGCCTCGGG + Intergenic
905385509 1:37600863-37600885 TACCCTCAGTTTTCAGTCTAGGG + Intergenic
906010155 1:42515711-42515733 TACTCCCTGCATCCAGCCTCTGG + Intronic
906723832 1:48029134-48029156 AACCTCCACCTTCCAGTTTCAGG + Intergenic
907450352 1:54542288-54542310 TGCCCGCAGCTTCCCGCCTCTGG + Intronic
908664364 1:66473728-66473750 TGCCACCAGGTTCCAGTTTCAGG + Intergenic
909197130 1:72641636-72641658 AAACACCAGCTGCCAGTCTCTGG + Intergenic
909931315 1:81502925-81502947 TATCCCCAGCAACCACTCTCAGG + Intronic
913079355 1:115367728-115367750 TATCCCCAGCTCCCAATCCCTGG + Intergenic
913091405 1:115479040-115479062 TGCTCCCTGCTTCCAGTCCCCGG - Intergenic
913297496 1:117336213-117336235 AAGCCCCAGCTGCCAGTCCCAGG + Intergenic
915834222 1:159161856-159161878 TGCCACCAGTTTCCAGTCCCAGG - Intergenic
915960587 1:160263115-160263137 TACTCCCAGCTGCCAGGCTGGGG + Intergenic
916891740 1:169118432-169118454 TGCCTCCAGCTCCCAGACTCAGG - Intronic
918147542 1:181770886-181770908 TACCCCTCTCTTCCTGTCTCAGG - Intronic
918779635 1:188682134-188682156 TTCCCCCACTTTCCAATCTCTGG - Intergenic
919482831 1:198110399-198110421 TAACACCAGCTTCCCGTGTCTGG + Intergenic
920501691 1:206489618-206489640 AACTCCCAGCTCCCAGGCTCAGG - Intronic
921179766 1:212622981-212623003 TTCCCCTTCCTTCCAGTCTCTGG + Intergenic
923931823 1:238708930-238708952 TAACACCAGCTTCCAGTTTTAGG + Intergenic
924133664 1:240939747-240939769 AGCCCCCAACTCCCAGTCTCTGG - Intronic
924266400 1:242286479-242286501 AGCCCCCAGTTTCCCGTCTCTGG - Intronic
1063669204 10:8086289-8086311 TACTTCCATCTTCCAGTTTCTGG + Intergenic
1063926059 10:10979016-10979038 TTCCCCAGGCTTCCAGTTTCAGG + Intergenic
1066718431 10:38312076-38312098 AGCCCCCAGTTTCCCGTCTCTGG + Intergenic
1069106546 10:64390132-64390154 TCCTCCCAGCCTCCAGCCTCTGG - Intergenic
1069405185 10:68091474-68091496 AACCTCCAGCTCCCAGGCTCAGG + Intergenic
1070358061 10:75659626-75659648 TTCCCCCACCTCCCAGTCCCTGG - Intronic
1071346380 10:84697887-84697909 TAGCTCCAGCTCCCTGTCTCTGG - Intergenic
1071568810 10:86685319-86685341 CACCCCTAGCTTCCACTCTGGGG + Intronic
1072712739 10:97727869-97727891 TCCTCCCTCCTTCCAGTCTCTGG + Intergenic
1073324509 10:102634509-102634531 CTCCCCCAGCCCCCAGTCTCCGG - Intergenic
1073467550 10:103703056-103703078 TGGCCCAAGCTCCCAGTCTCAGG - Intronic
1075936601 10:126347861-126347883 GACTCCCAGCCTCCACTCTCAGG - Intronic
1075998416 10:126896204-126896226 TACCCCCATCCTCCAGTCCCAGG + Intergenic
1077600236 11:3569573-3569595 CAGGCCTAGCTTCCAGTCTCGGG + Intergenic
1077924846 11:6671416-6671438 TAAACCCAGCTTCTTGTCTCTGG - Intergenic
1078459683 11:11504674-11504696 AACCTCCACCTTCCAGGCTCAGG - Intronic
1078757227 11:14222673-14222695 TACCTCCAGCTTCCAGCTTAAGG + Intronic
1080616270 11:33947457-33947479 GACCCCCAGCTTCCTCCCTCTGG + Intergenic
1080746597 11:35113638-35113660 TCCTCCCAGCCCCCAGTCTCTGG - Intergenic
1081187093 11:40057023-40057045 TACCCCCATTCCCCAGTCTCTGG - Intergenic
1081606331 11:44529345-44529367 TCTCCCCAGCTTCCTGTTTCTGG - Intergenic
1081807623 11:45899137-45899159 TACCCCAACCTTCCACTCTCTGG + Intronic
1082030465 11:47599834-47599856 CACTCCCAGCTTCCCCTCTCCGG - Intergenic
1082067330 11:47911330-47911352 GACTCCCAGCTTCAAGTCTGGGG - Intergenic
1083901012 11:65643486-65643508 TGTCCCCAGCATCCAGTCTGAGG - Intronic
1084256148 11:67944187-67944209 CAGGCCTAGCTTCCAGTCTCGGG + Intergenic
1084691440 11:70729367-70729389 TTCCCCCAGCCCCCAGTCCCTGG - Intronic
1084816610 11:71651112-71651134 CAGGCCTAGCTTCCAGTCTCGGG - Intergenic
1085023949 11:73225816-73225838 TGCCCTCATCTTCCTGTCTCAGG - Intronic
1085425600 11:76402009-76402031 GAAGCCCAGCTTCCAATCTCAGG + Intronic
1085489462 11:76901397-76901419 CAAAACCAGCTTCCAGTCTCTGG - Intronic
1086831351 11:91568859-91568881 TAACTCCCTCTTCCAGTCTCTGG + Intergenic
1087526655 11:99322207-99322229 TTCCCCCAGCTTGCAGTCGGCGG + Intronic
1089257334 11:117200793-117200815 TACCCCCAGCTTCCAGTCTCAGG - Intronic
1090248954 11:125237783-125237805 AACCCACAGCTTCAAGTGTCAGG + Intronic
1090874357 11:130775536-130775558 TAACACCAGATTCCAGACTCTGG + Intergenic
1090964277 11:131584766-131584788 TGCCCACAGCCTGCAGTCTCTGG + Intronic
1092426382 12:8378933-8378955 CAGGCCTAGCTTCCAGTCTCGGG + Intergenic
1092796199 12:12112286-12112308 AACCTCCACCTTCCAGGCTCAGG - Intronic
1093494528 12:19740894-19740916 CATCCCCAGCTTCCAGTCTCTGG + Intergenic
1096532226 12:52249286-52249308 CTGCCCCAGCTTCCAGTTTCGGG + Intronic
1096997457 12:55847733-55847755 CACCTCCAGTTTCCAGTTTCAGG - Intergenic
1097801478 12:63919175-63919197 TAGTCCCAGCTTCCAGTCCCAGG - Intronic
1097964118 12:65560909-65560931 TTCCCCCTTCTTCCAGACTCTGG + Intergenic
1099135565 12:78894754-78894776 CATCCCCACCTCCCAGTCTCTGG - Intronic
1099854025 12:88141793-88141815 TACCCCGCCCTTCCAGCCTCGGG - Intronic
1100268504 12:93001208-93001230 TTCCCCCAGCCCCCAGCCTCTGG + Intergenic
1100315021 12:93437226-93437248 TACCTTCAGCCTCCAGTATCTGG - Intronic
1101559445 12:105842103-105842125 TCCTCCCAGCTTCTGGTCTCTGG - Intergenic
1105243753 13:18629114-18629136 GGCCCCCAACCTCCAGTCTCCGG - Intergenic
1106112470 13:26789129-26789151 GACCCCCTGCTTTCGGTCTCAGG - Intergenic
1106709237 13:32313056-32313078 TCCCCCCAACTTCCTGTCCCTGG - Intronic
1106760533 13:32863262-32863284 TTCTCCCTGCTTCCAGCCTCTGG + Intergenic
1108713054 13:53053300-53053322 TACCCCCACCCTCCAGTCTCTGG + Intergenic
1110671995 13:78191436-78191458 TAGCCCCACCTGCCAATCTCTGG - Intergenic
1110762325 13:79244341-79244363 AACCCCCACCTCCCAGGCTCAGG + Intergenic
1113519851 13:110932592-110932614 CACCCCCAACTCCCAGTCCCTGG + Intergenic
1114053104 14:18940165-18940187 TACCCCCAGTTTCCAAATTCTGG - Intergenic
1114109454 14:19461761-19461783 TACCCCCAGTTTCCAAATTCTGG + Intergenic
1114451656 14:22830312-22830334 TACCCCCAGCTCCCCGTCCAGGG - Intronic
1118366589 14:65102096-65102118 TTCCCCCAACCTCCAGTCCCAGG + Intronic
1119043476 14:71296488-71296510 TAGCCCCAGCTTCCATGCTCTGG - Intergenic
1119874475 14:78045740-78045762 TTCCCCCACCTTCCAGCCCCTGG - Intergenic
1120040781 14:79750593-79750615 TACCCCCAGGTTCTACTTTCAGG - Intronic
1121335365 14:93074670-93074692 GAGCCCCAGCTGTCAGTCTCAGG + Intronic
1122625994 14:103085582-103085604 TACTCCCAGCCTCCCGTCTCAGG + Intergenic
1125072240 15:35568902-35568924 TTCCCCCTTCTTCCAGCCTCTGG + Intergenic
1125180629 15:36878468-36878490 GCACCCCAGCTTCCTGTCTCGGG + Intergenic
1128264593 15:66254978-66255000 GACACACAGCTCCCAGTCTCAGG - Intergenic
1129294279 15:74591408-74591430 TATCCCCAGCAACCACTCTCAGG + Exonic
1131000920 15:88939284-88939306 CACCCCCAGCTTCCAGGCCCAGG + Intergenic
1132108692 15:99086173-99086195 CATGCCCAGCTTCCAGTCTACGG + Intergenic
1132202200 15:99962728-99962750 TACCTTGACCTTCCAGTCTCTGG + Intergenic
1132677835 16:1127947-1127969 AAGCCACATCTTCCAGTCTCGGG + Intergenic
1132678955 16:1131883-1131905 TCGCCCGAGCTTCCAGTCACGGG - Intergenic
1132739515 16:1404480-1404502 GACCCTCAGCTTTCAGTGTCTGG - Intronic
1133371942 16:5251998-5252020 CAGGCCTAGCTTCCAGTCTCAGG - Intergenic
1133802450 16:9094520-9094542 CACCCCCACCTCCCAGTCCCTGG + Intronic
1134444701 16:14321973-14321995 AACCCAGAGCTTCCAGTCCCTGG + Intergenic
1135484871 16:22855424-22855446 TACCTTCAGCTTCCAGGCCCTGG + Intronic
1135668317 16:24354109-24354131 TAGCCTCACCTTCCAGGCTCAGG - Intronic
1138519524 16:57563157-57563179 GACACCCACCATCCAGTCTCTGG + Exonic
1139531577 16:67545158-67545180 TTCCCCGAGCTTCCTGTCACTGG - Intronic
1140226081 16:73078579-73078601 TACCCCCAGCCACCTGCCTCTGG + Intergenic
1140551177 16:75867578-75867600 TCCTCCCACCTTCCACTCTCTGG + Intergenic
1141665156 16:85462137-85462159 TGTCCCCAGCACCCAGTCTCGGG + Intergenic
1141878629 16:86843183-86843205 TACCCCTGGGGTCCAGTCTCAGG - Intergenic
1141984420 16:87570752-87570774 TGCCCCCAGCATCCAGTGTTTGG - Intergenic
1143609290 17:8008293-8008315 CAGCTCCAGCCTCCAGTCTCTGG - Intronic
1144869268 17:18358819-18358841 AACCTCTAGCTTCCAGGCTCAGG - Intronic
1145213500 17:21034151-21034173 AAACCTCAGCTTCCAGACTCAGG + Intronic
1146474903 17:33154966-33154988 AAGGCCAAGCTTCCAGTCTCTGG + Intronic
1146925100 17:36739099-36739121 TACCCCCAGCTCCCTGTTTCTGG - Intergenic
1147763931 17:42820182-42820204 TACCCACAGCTGCCAGTCACTGG - Intronic
1147910425 17:43852934-43852956 TTCTCCCACCTTCCAGCCTCTGG + Exonic
1148906356 17:50914971-50914993 TGCCCCCAGCCTGCGGTCTCTGG + Intergenic
1152580520 17:81163723-81163745 TGCCCACAGCCTCCACTCTCAGG + Intronic
1153549310 18:6244720-6244742 TTCCCTCAACTTCCAGCCTCTGG - Intronic
1155199159 18:23502714-23502736 CAGCCCCAACTCCCAGTCTCTGG - Intergenic
1155318961 18:24599490-24599512 TACTCCCAGCTTCCAGCTTGGGG + Intergenic
1156480001 18:37430375-37430397 GACCCCAAGTCTCCAGTCTCTGG - Intronic
1156503382 18:37574181-37574203 TACCCCCTGCCTCCATTGTCAGG + Intergenic
1156853554 18:41755776-41755798 TACCCCCAATTTTCAGTCTCTGG + Intergenic
1157052429 18:44182310-44182332 ATCCACCAGCTTCCAGTCCCAGG + Intergenic
1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG + Intergenic
1159874277 18:73792971-73792993 TCCCCCCAACTTCCCTTCTCTGG + Intergenic
1160129559 18:76212789-76212811 TCCCCCCAGCTCCCTCTCTCCGG + Intergenic
1161783168 19:6307021-6307043 TACCGCCAGGTCCCAGTGTCTGG + Intronic
1162415250 19:10532204-10532226 TGCACCCAGCCTCCAGTGTCTGG + Intergenic
1163761140 19:19137431-19137453 TCCACCCAGCCTCCTGTCTCAGG + Intronic
1165083909 19:33329380-33329402 TACCTGCTGCTTCCAGTCTCCGG + Intergenic
1165730771 19:38143287-38143309 TGCCCCCAGGTCCCTGTCTCAGG + Intronic
1165774703 19:38397657-38397679 AACCCCAAGGTTCCAGCCTCTGG + Intergenic
1167015523 19:46838599-46838621 GAGCCCCAGCTTCCAGGGTCCGG - Intronic
1167837637 19:52087360-52087382 TCCTCCCACCTTCCACTCTCAGG + Intronic
925424456 2:3737110-3737132 TACCCCCAGGTGCCAGGCCCTGG + Intronic
925460000 2:4053883-4053905 GATCCCCAGCTGCCAGTATCTGG + Intergenic
925913947 2:8591012-8591034 TATCCCCAGCTTCTAGTTTATGG + Intergenic
927592008 2:24364641-24364663 TGCCCCAGGCTTCAAGTCTCAGG - Intergenic
929770215 2:44885571-44885593 CATCCCCAGCTTCCAGTCCTGGG + Intergenic
929871723 2:45764733-45764755 TAACCCCAGCCTCAAGTTTCTGG - Intronic
930105384 2:47635055-47635077 TACCACAAGCTCCCAGTATCTGG - Intergenic
930825506 2:55693280-55693302 GAGCCCCAGCTTCCAGGGTCCGG + Intronic
932434487 2:71695122-71695144 GAGCCCCCGCTTCCAGTCTGAGG - Intergenic
933139050 2:78770651-78770673 CACCCCTATCTCCCAGTCTCTGG - Intergenic
935648104 2:105358462-105358484 TTCCTCCAGCTACCAGTCTAGGG - Intronic
937540442 2:122945149-122945171 TTCCCCCAACTCCCAGGCTCTGG - Intergenic
939380996 2:141435927-141435949 TTCTTCCAGCTTCCAGTCTGGGG - Intronic
940603768 2:155894062-155894084 TGCCCCATGCTTCCAGCCTCAGG + Intergenic
942171397 2:173292930-173292952 TACTCCCAGCTTCCAAATTCTGG + Intergenic
945840055 2:214876892-214876914 TCCTCCTGGCTTCCAGTCTCTGG + Intergenic
946767043 2:223050473-223050495 TACTCAAAGCTTCCAGTCTTTGG + Intergenic
1169291248 20:4354803-4354825 TTCCCCCAGTTTCCAGCCTAGGG - Intergenic
1170001077 20:11614883-11614905 AATCCCCAACCTCCAGTCTCTGG - Intergenic
1170610306 20:17907415-17907437 TACCTTCATCTTCCAGGCTCAGG + Intergenic
1173032491 20:39375198-39375220 TACCCCCACCCTCCAATCTTTGG + Intergenic
1173201052 20:40955386-40955408 TCCTCCCACCCTCCAGTCTCCGG + Intergenic
1173384097 20:42572447-42572469 TTCCCCCAGCTTCCACCCACAGG + Intronic
1175190887 20:57211493-57211515 TACCCACAGCTTCCTGGGTCAGG - Intronic
1175344814 20:58265299-58265321 TTCCTTCTGCTTCCAGTCTCTGG - Intergenic
1175640128 20:60622307-60622329 TACCCCCAACATGCTGTCTCTGG + Intergenic
1176130942 20:63496590-63496612 GCCCCCCAGCTTCCCGTGTCCGG - Intronic
1177029890 21:15969243-15969265 TGCCTCCAGCTTCCTGTCTTGGG + Intergenic
1177072173 21:16524215-16524237 TTCCCACAGCTTCCTGCCTCTGG - Intergenic
1177520382 21:22214078-22214100 TTCTCCCTGCTTCCTGTCTCTGG - Intergenic
1178336551 21:31748970-31748992 AACCTCCACCTTCCAGGCTCAGG + Intergenic
1178771126 21:35505201-35505223 CAGCCCCAGGTTCCAGCCTCCGG - Intronic
1180471577 22:15662540-15662562 TACCCCCAGTTTCCAAATTCTGG - Intergenic
1183865505 22:40701062-40701084 AGCCCCCAACTTCCAGTCTCTGG - Intergenic
949928132 3:9058068-9058090 TACCCTCATCTTGCTGTCTCAGG - Intronic
950440887 3:13009561-13009583 TAACTCCAACTTCCAGGCTCAGG + Intronic
952616158 3:35276499-35276521 TACCTCCAGCTGCCTGTCTATGG + Intergenic
953698949 3:45181255-45181277 ATCCCCCAGCTTCCAGGCTCGGG - Intergenic
954609937 3:51939037-51939059 TACCCCCAGCTCCCAGGAGCAGG - Intronic
955599430 3:60629188-60629210 TCCCCTCAGCTTCCAGTCAAGGG - Intronic
955950172 3:64235839-64235861 TCCACCTAGCTTCTAGTCTCGGG - Intronic
957184167 3:76921020-76921042 TCCCCCCACCCTCCATTCTCTGG - Intronic
960474061 3:118102373-118102395 TTCCCCCAACCTCCAGCCTCTGG + Intergenic
961283051 3:125778500-125778522 CAGGCCTAGCTTCCAGTCTCGGG - Intergenic
961352558 3:126313285-126313307 GACCTCCAACTTCCAGCCTCTGG + Intergenic
964606861 3:158569854-158569876 TACCCCATGCCACCAGTCTCAGG + Intergenic
965800599 3:172489781-172489803 TTCCTCCATCCTCCAGTCTCTGG - Intergenic
966928106 3:184658701-184658723 TCCCACCAGCTTCCTGTCCCAGG + Intronic
968002931 3:195220071-195220093 TCCCCCCAGCTCCCAGCATCAGG - Intronic
968540558 4:1166263-1166285 AGCCCCCACCTTCCAGTCACTGG + Intergenic
968835446 4:2961390-2961412 AGCCCCCAGGTGCCAGTCTCAGG - Intronic
969014663 4:4095922-4095944 CAGGCCTAGCTTCCAGTCTCGGG + Intergenic
969038507 4:4275524-4275546 AACCTCCAGCTCCCAGACTCAGG + Intronic
969739277 4:9012519-9012541 CAGGCCTAGCTTCCAGTCTCGGG - Intergenic
969798460 4:9544032-9544054 CAGGCCTAGCTTCCAGTCTCGGG - Intergenic
975654393 4:76627194-76627216 TTCTCCCAACTTCCAGACTCAGG + Intronic
976711249 4:88073599-88073621 CTCCCCCAACTTCCAGTCTAGGG - Intronic
977910116 4:102524516-102524538 CACCCCCAGCCCCCAGTCTGTGG - Intronic
978762782 4:112372778-112372800 TCCCCCCATCCTGCAGTCTCTGG + Intronic
982430789 4:155319703-155319725 CATCCCTATCTTCCAGTCTCTGG - Intergenic
982632200 4:157845073-157845095 AACCTCCACCTTCCAGGCTCAGG + Intergenic
982915378 4:161202606-161202628 TAACCCCAGCCCCCATTCTCTGG - Intergenic
983354322 4:166636617-166636639 CCCCTCCAGCTTCCAGTATCTGG - Intergenic
984130929 4:175875204-175875226 TTCCCACAGCTCCCAGTTTCTGG + Intronic
985427869 4:189847708-189847730 GAACCCCAGCGTCCTGTCTCAGG - Intergenic
985854015 5:2411072-2411094 GATCCCCAGCTTCCATTCTCTGG - Intergenic
988389736 5:30612346-30612368 AACCCCCAATTCCCAGTCTCTGG + Intergenic
989751639 5:44901678-44901700 TACCCCCAGAGTTCAGTCTTTGG - Intergenic
992658213 5:78931489-78931511 TTCCTCCAGCTGCCTGTCTCTGG + Intronic
994954269 5:106507193-106507215 TCCCCACAGCTCCCAGCCTCTGG - Intergenic
996119856 5:119659053-119659075 TACTCCCAGCTTCTAGTGTAAGG - Intergenic
996254385 5:121380404-121380426 TTCCCCTACCTTCCAGTCTGTGG - Intergenic
998380004 5:141717569-141717591 AACCCCCAGGTTCCTGTGTCAGG - Intergenic
998802936 5:145889074-145889096 TGCCTCCAGCTTCCAGGTTCAGG - Intergenic
999136710 5:149325325-149325347 TTCCCCCAGCTGCCAGTCAAGGG + Intronic
999343208 5:150791407-150791429 TCCCCCGACCTTCCAGCCTCTGG + Intronic
999733788 5:154497524-154497546 AACCTCCACCTTCCAGGCTCAGG + Intergenic
1002063319 5:176639478-176639500 TTCCCACAGCTTCCAGCCTGGGG - Intronic
1004152967 6:13138217-13138239 AGCCCCCATCTTCCAGTCTCTGG - Intronic
1005520324 6:26595715-26595737 TACTCCCTGCTTCCATTCTCTGG + Intergenic
1005919216 6:30383943-30383965 TCCTCCCAGCCTCCACTCTCTGG + Intergenic
1005959487 6:30685551-30685573 TATCCCCAGCCTCCTCTCTCTGG + Exonic
1006792928 6:36715555-36715577 TACCACCAGCTTCCCAGCTCTGG + Exonic
1007130345 6:39466652-39466674 TCCCCCTAGCTCCCAGTCTAAGG + Intronic
1010217837 6:73420542-73420564 TTCCCCCAGCTTTGACTCTCTGG - Intronic
1010408909 6:75538090-75538112 TACACCCAACTTCTAATCTCAGG + Intergenic
1010651351 6:78458714-78458736 AAACCCCACCCTCCAGTCTCTGG - Intergenic
1013151356 6:107449443-107449465 TTCCCCCTTCTTCCAGTCCCTGG + Intronic
1015705194 6:136080300-136080322 TACCCCCAGCTTTAAATCCCTGG + Intronic
1016470109 6:144366395-144366417 TCCTCCCATCTTCCAGCCTCTGG + Intronic
1017016097 6:150100697-150100719 CACCCCCAGCTTCCAGGCCCCGG - Intergenic
1017891170 6:158640558-158640580 TGCCCCCACTTCCCAGTCTCAGG + Intronic
1019747382 7:2708522-2708544 GACCCCCATCTTCCAGGCTCAGG - Intronic
1023503148 7:40872056-40872078 TATCCCCAGCTTCTACTCCCTGG - Intergenic
1025074340 7:55929671-55929693 AACCTCCACCTTCCAGGCTCAGG - Intronic
1026846613 7:73702355-73702377 TCACCTCAGCTGCCAGTCTCTGG + Intronic
1027568078 7:79824137-79824159 TTCCCCCACCTTCCAGCCCCTGG + Intergenic
1029073340 7:97917551-97917573 CAGGCCTAGCTTCCAGTCTCGGG + Intergenic
1029116742 7:98241484-98241506 CACCACCTGATTCCAGTCTCAGG + Intronic
1031012663 7:116539859-116539881 CACCCCCAGCCTCCACACTCTGG - Intronic
1031980921 7:128123748-128123770 CGGCCCCAGGTTCCAGTCTCTGG + Intergenic
1032197867 7:129799676-129799698 TGCCCCCAGCTTCCAGCCCTGGG + Intergenic
1032274067 7:130439532-130439554 TCCCCCCACCCTCCAGGCTCTGG + Intronic
1036244349 8:7103739-7103761 CAGGCCTAGCTTCCAGTCTCGGG - Intergenic
1036256393 8:7210000-7210022 CAGGCCTAGCTTCCAGTCTCGGG + Intergenic
1036308443 8:7668585-7668607 CAGGCCTAGCTTCCAGTCTCGGG + Intergenic
1036361091 8:8077492-8077514 CAGGCCTAGCTTCCAGTCTCGGG - Intergenic
1036576195 8:10029645-10029667 TTCCCCCTGCTTCCTGTCTGTGG - Intergenic
1036889875 8:12589509-12589531 CAGGCCTAGCTTCCAGTCTCGGG + Intergenic
1036897483 8:12647670-12647692 CAGGCCTAGCTTCCAGTCTCGGG + Intergenic
1037419125 8:18683325-18683347 TTCCCCCAGCCCCCAGTCTGTGG - Intronic
1037692395 8:21193079-21193101 GAGCCCAAGTTTCCAGTCTCTGG - Intergenic
1039209153 8:35192141-35192163 CACCCCCAGCTCTCAGTCCCTGG + Intergenic
1039812551 8:41062606-41062628 TATCCCCACCCTCCAGTCCCTGG + Intergenic
1039975928 8:42364778-42364800 TACCCCCTCCTTCCAGGCCCTGG - Intronic
1041290309 8:56302302-56302324 CTCCCACAGCTTCAAGTCTCTGG + Intronic
1043360237 8:79463613-79463635 TACCACCTGATTCCTGTCTCTGG - Intergenic
1045288287 8:100810574-100810596 TCTCCCCAGCTTCCTGTCTCTGG + Intergenic
1045597921 8:103677548-103677570 TACCCACAGTCTCCAGTTTCTGG + Intronic
1047437909 8:124850294-124850316 TCCCCCCTCCCTCCAGTCTCTGG + Intergenic
1048916823 8:139192602-139192624 TACCCCATGCTCCCAGCCTCTGG - Intergenic
1049428666 8:142549300-142549322 CCTCCCCTGCTTCCAGTCTCAGG - Intergenic
1050562879 9:6852744-6852766 TACCTCCAGGTACCAGGCTCTGG + Intronic
1053527957 9:38848654-38848676 GACCTCCAGCTCCCAGTTTCAGG + Intergenic
1054200178 9:62073089-62073111 GACCTCCAGCTCCCAGTTTCAGG + Intergenic
1054638177 9:67515271-67515293 GACCTCCAGCTCCCAGTTTCAGG - Intergenic
1055983315 9:82028737-82028759 TTCCCCCACCTTCCAGTCCCTGG - Intergenic
1055984423 9:82041650-82041672 CTCCCCTAGCTTCCAGTCTAGGG - Intergenic
1059067577 9:111101832-111101854 TACCACCAGCATCTAGTCTGTGG - Intergenic
1059322848 9:113482824-113482846 TCCCACCATCTTCCACTCTCTGG - Intronic
1059329295 9:113524861-113524883 CACCCCTAGCTTCAAGTCTGGGG - Intronic
1059768046 9:117402481-117402503 TACCCACATCTTCCCATCTCAGG - Intronic
1060177428 9:121507368-121507390 TGACCCCAGCTTTCAGGCTCTGG + Intergenic
1203784681 EBV:120910-120932 TACCCCTGGCTTCCACTCACGGG - Intergenic
1186074767 X:5866139-5866161 TACCACCAGCTGCAGGTCTCAGG - Intronic
1188269948 X:28127098-28127120 TGCCCCTATCTGCCAGTCTCTGG + Intergenic
1188368298 X:29336996-29337018 TTCTCCCACCCTCCAGTCTCCGG - Intronic
1189005947 X:36995118-36995140 AACTCCCAGCTTCTAGTTTCTGG + Intergenic
1189042644 X:37558684-37558706 AACTCCCAGCTTCTAGTTTCTGG - Intronic
1189675984 X:43461026-43461048 TTCCCCCTGTTCCCAGTCTCTGG - Intergenic
1190297125 X:49034238-49034260 TGCCCCCAGCTGCCTGTGTCAGG - Exonic
1193214472 X:78846951-78846973 TTCCCCCACCTTCCAGACCCTGG - Intergenic
1200666765 Y:6034560-6034582 TATCCCCAGTTTACTGTCTCTGG + Intergenic