ID: 1089258697

View in Genome Browser
Species Human (GRCh38)
Location 11:117207816-117207838
Sequence TTCACGGATGGGCACACTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089258691_1089258697 30 Left 1089258691 11:117207763-117207785 CCAGGGAATATGAGAGGTAGTAT 0: 2
1: 0
2: 0
3: 9
4: 95
Right 1089258697 11:117207816-117207838 TTCACGGATGGGCACACTCTTGG 0: 2
1: 0
2: 0
3: 9
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089258697 Original CRISPR TTCACGGATGGGCACACTCT TGG Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900500462 1:3002008-3002030 TTCTCGGACGCCCACACTCTCGG + Intergenic
900866817 1:5274923-5274945 TTCACAGATGGGGAAACCCTGGG + Intergenic
900882310 1:5390976-5390998 TTGACGGCAGGGCACCCTCTGGG + Intergenic
902915491 1:19636597-19636619 TTCACAGAAGGGCCCACTCTTGG + Intronic
903025764 1:20429015-20429037 TTCACAGATGGGCAGACTGAGGG + Intergenic
904156639 1:28488863-28488885 TTCACGGATGAGGACACTCAAGG + Intronic
912668729 1:111606569-111606591 AGCACGGCTGGGCACACTCTTGG - Intronic
916682358 1:167116039-167116061 TTCCCTGATGGGCAGTCTCTGGG - Intronic
919817639 1:201451449-201451471 TTCCCTGCTGGGCACACCCTTGG + Intergenic
920104386 1:203540854-203540876 TTCAAGGCTGGCCACTCTCTGGG - Intergenic
924455716 1:244217470-244217492 TTCAGGGATTTACACACTCTAGG + Intergenic
1065184887 10:23162084-23162106 GTCCCTGATGGGCACACTCCAGG - Intergenic
1065767547 10:29045133-29045155 TTCAGAGATTGGCAAACTCTTGG - Intergenic
1067562070 10:47311134-47311156 GTCACAGATTGCCACACTCTGGG - Intronic
1075763240 10:124872490-124872512 GTCCCTGATGGGCACACACTAGG - Intergenic
1077561335 11:3263590-3263612 TTCACGGAGGGACACACCCTGGG + Intergenic
1077567231 11:3309419-3309441 TTCACGGAGGGACACACCCTGGG + Intergenic
1078190335 11:9088930-9088952 TTCACAGATGGGGACACTGAGGG - Intronic
1089248017 11:117136745-117136767 TTCACGGATGGGCACACTCTTGG - Intergenic
1089258697 11:117207816-117207838 TTCACGGATGGGCACACTCTTGG + Intronic
1091936558 12:4439498-4439520 TTCTCAAATGGGCACATTCTAGG - Intronic
1092486939 12:8910142-8910164 TTCACAGATGGGGACATCCTTGG + Intergenic
1096469347 12:51866261-51866283 TTCAGGGATTGGCCCACCCTGGG - Intergenic
1106886963 13:34197270-34197292 TCCATGGATGGGCATAGTCTGGG + Intergenic
1125979774 15:43989683-43989705 TTCATAGATGGGCACAGTGTGGG + Intronic
1132232379 15:100193612-100193634 TTGACCGATGCGCTCACTCTCGG - Intronic
1135459359 16:22628120-22628142 TTTACCCATGGGAACACTCTGGG + Intergenic
1137957906 16:52852132-52852154 TTCACTAATAAGCACACTCTAGG - Intergenic
1140958760 16:79892635-79892657 GTCACTGATGGGCACATTCAAGG - Intergenic
1141388636 16:83646097-83646119 TTCACGTATGGTCCCACACTAGG - Intronic
1142035807 16:87861600-87861622 TCCAAGGTAGGGCACACTCTTGG - Intronic
1145720332 17:27065491-27065513 TTCACCCATGGGCACAGTTTAGG - Intergenic
1146675621 17:34772071-34772093 TACATGGATTGGCACACTCCCGG - Intergenic
1146793255 17:35764745-35764767 TTGACGGATGGGGGCGCTCTGGG - Exonic
1147156246 17:38545762-38545784 TGCACAGATGGGCACGCTCATGG - Intronic
1147615587 17:41825450-41825472 TTCACGGGGGAGCAGACTCTGGG + Intronic
1153760819 18:8330221-8330243 TTCACCCATGGGCACAGTTTAGG + Intronic
1157476100 18:48024492-48024514 TTCAGGAAGGGGCAGACTCTGGG + Intergenic
1161879020 19:6934184-6934206 TGCACGGATGGGCAAGCTGTAGG + Intronic
1162031131 19:7917707-7917729 TGCACGGCCGGGGACACTCTTGG - Exonic
1163008811 19:14412207-14412229 TTCACAGATGGACACTCTCTAGG + Intronic
1163705329 19:18809141-18809163 TGCAGAAATGGGCACACTCTGGG - Intergenic
1167674272 19:50874805-50874827 GTCATGGATGGGCACACTGTGGG + Exonic
930594810 2:53374152-53374174 TTCACTAATGGGGATACTCTTGG - Intergenic
937804125 2:126117681-126117703 TTCACACATGGGCACATACTTGG + Intergenic
943261729 2:185673378-185673400 TTCACAAATGGGCACACAGTTGG + Intergenic
943763359 2:191633332-191633354 TCCACAGCAGGGCACACTCTGGG - Intergenic
1168804193 20:663101-663123 TCCCCAGATGGACACACTCTGGG + Exonic
1170006776 20:11678102-11678124 TTTAAGGCTGGGCAAACTCTGGG + Intergenic
1172177864 20:32983617-32983639 TTCACGGATGGGGACAGTGAAGG - Intergenic
1173197533 20:40928213-40928235 GTCAGGGAAGGCCACACTCTGGG - Intergenic
949269634 3:2199681-2199703 TTCACAGAAATGCACACTCTAGG - Intronic
950572349 3:13809278-13809300 TTTACAGATGGGGAAACTCTGGG + Intergenic
954081595 3:48215396-48215418 TTCACAGATGGGCAACTTCTTGG + Intergenic
959302355 3:104619202-104619224 AACACGTATGGACACACTCTAGG + Intergenic
960161065 3:114350959-114350981 TTCACCTTTGGGCTCACTCTCGG + Exonic
962453270 3:135539702-135539724 TTCACTGCAGGCCACACTCTGGG + Intergenic
965530741 3:169768053-169768075 CTCAAAGATGGGCACACTCTGGG + Exonic
983968540 4:173843787-173843809 TGCAAGGATGGGGACACTCATGG + Intergenic
984751679 4:183283442-183283464 TTCATGGATGCTCACACACTGGG + Intronic
985550619 5:531675-531697 TACAGGGCTGGGCACGCTCTAGG + Intergenic
986712578 5:10498751-10498773 TCCACGTAAGGGCTCACTCTGGG + Intergenic
992323000 5:75632503-75632525 TTCAGGGATGGTCACATGCTAGG - Intronic
992801537 5:80300306-80300328 TTCATAGATGGGCACAGTGTTGG + Intergenic
1004059344 6:12176908-12176930 GTCACTGATGGGCACACATTAGG - Intergenic
1005768758 6:29042807-29042829 TCAACGGGGGGGCACACTCTGGG + Intergenic
1007947126 6:45836788-45836810 TTCAAGGCTGGGCCCAATCTTGG - Intergenic
1012360459 6:98371484-98371506 TTCATGTATGTTCACACTCTTGG + Intergenic
1019062135 6:169264041-169264063 TTGGCGGATGGGCCCGCTCTTGG + Intergenic
1028347573 7:89801044-89801066 TTTCCTGATAGGCACACTCTTGG + Intergenic
1028431291 7:90749754-90749776 TTCATGTTTAGGCACACTCTGGG + Intronic
1029713743 7:102314446-102314468 TTGAAGGAGGGGCACACTCAGGG + Intronic
1039873630 8:41567451-41567473 TTCAGGGATGCCCGCACTCTCGG + Intergenic
1041546417 8:59048355-59048377 TTCATGGATGTGCAGACTCAGGG - Intronic
1045225065 8:100235993-100236015 TTTACAGATGGCCAAACTCTTGG + Intronic
1050302504 9:4274040-4274062 TTCACAAATGGGCAGAGTCTAGG - Intronic
1050561092 9:6834933-6834955 CTCGCAGATGGGCACACTGTGGG - Intronic
1050676700 9:8063657-8063679 TCCACAGCTGGGCACTCTCTTGG - Intergenic
1051226257 9:14902402-14902424 TTCACTGATGGGAAAACTCTGGG - Intronic
1055652681 9:78422236-78422258 CTCACGCAAGGGCATACTCTAGG - Intergenic
1058321425 9:103636318-103636340 TTCAGGGATGGCCAGACTCCAGG + Intergenic
1060497701 9:124130368-124130390 CTCACGGACGGGAACACCCTGGG - Intergenic
1060868309 9:127017880-127017902 TTCAGGGATGGTCACACACATGG + Intronic
1185615104 X:1416520-1416542 TGCACAGATGGGCACACGCACGG + Intronic
1199771938 X:150980796-150980818 CTCACGTATGGGCACACCCAGGG - Intronic