ID: 1089260374

View in Genome Browser
Species Human (GRCh38)
Location 11:117220084-117220106
Sequence CCTTTGCCCTGCCCTGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089260374_1089260376 -5 Left 1089260374 11:117220084-117220106 CCAATAGCAGGGCAGGGCAAAGG 0: 1
1: 0
2: 2
3: 32
4: 261
Right 1089260376 11:117220102-117220124 AAAGGAAACCCTAACCCTCCTGG 0: 1
1: 0
2: 3
3: 16
4: 122
1089260374_1089260382 15 Left 1089260374 11:117220084-117220106 CCAATAGCAGGGCAGGGCAAAGG 0: 1
1: 0
2: 2
3: 32
4: 261
Right 1089260382 11:117220122-117220144 TGGCCTCCTAACAGAATATCTGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089260374 Original CRISPR CCTTTGCCCTGCCCTGCTAT TGG (reversed) Intronic
900707203 1:4088323-4088345 GCCTTGCCCTGCCCTGCTCTCGG - Intergenic
903022167 1:20401955-20401977 TCTGTGCCCTGCCCTGGCATGGG - Intergenic
903479608 1:23643759-23643781 CCTTTGCCCTTAACTGCTAGTGG + Intergenic
905926192 1:41751609-41751631 CCTTTCCCCTGTCCTTCTCTTGG + Intronic
906384017 1:45351802-45351824 CCTTCGCCCTTCCCTGAAATAGG + Intronic
906509256 1:46401505-46401527 TTTTTGCCCTTCCCTGCTAGAGG + Intronic
907043917 1:51288058-51288080 CCCCTGCCCTGCCCTGCCTTTGG - Exonic
908612603 1:65879216-65879238 TCTTTTCCCTTCCCTGCTTTGGG - Intronic
908776981 1:67649842-67649864 CCTTTCCCCTCTCCTTCTATAGG - Intergenic
908776999 1:67649993-67650015 CCTTTGCCATGCTCTGACATTGG + Intergenic
910669450 1:89758300-89758322 CCTGAGCCCTGCCCTGCTACAGG + Intronic
912332028 1:108828594-108828616 GCTGTGCCCTGGCCTGCTGTTGG + Intronic
912449208 1:109759031-109759053 CCTCTGCCCAGCCCACCTATGGG - Intronic
912719043 1:112004347-112004369 CCTGTGCCCTTCCAGGCTATGGG - Intergenic
917519699 1:175737770-175737792 CCTTGGCAGTGCCCTGCTCTAGG + Intronic
917922298 1:179760574-179760596 CTTCTGCCCTGCCATGCTGTTGG - Intronic
919371516 1:196733545-196733567 CCTTTTCTCTGCACTGCTCTTGG + Intronic
921157506 1:212449971-212449993 CCTCTGCCCTGCTCTTCTTTGGG - Intergenic
923319081 1:232812107-232812129 CTTTTGCCTTGCTATGCTATAGG - Intergenic
924173368 1:241364579-241364601 GCTATGCCTTGCCCTCCTATGGG - Intergenic
924577860 1:245296660-245296682 ACTTTTCCCTGCCCAGCTACTGG + Intronic
1064282192 10:13960880-13960902 ACTCTGCCCTGCCCTCCTCTGGG - Intronic
1064985825 10:21208824-21208846 CTTTTTCCCTGCCATGCTGTTGG - Intergenic
1065355791 10:24840209-24840231 GCTGTGCCCGGCCCTGCCATAGG + Intergenic
1066305500 10:34136538-34136560 CCTTTTCTCCCCCCTGCTATGGG - Intronic
1066351121 10:34637692-34637714 CATTTGCTCTGCCCTTCTTTAGG - Intronic
1066658409 10:37716480-37716502 CCTTTGCTCTGCCTTGCTCTGGG + Intergenic
1066759554 10:38739207-38739229 CCCTTGCCCTGCCCTCCGTTTGG + Intergenic
1067042907 10:42966155-42966177 CCTTTGCTCTGCCTTGCTCTGGG + Intergenic
1067155133 10:43775236-43775258 CCTCCGCACTGCCCTGCTGTAGG - Intergenic
1068340996 10:55702566-55702588 TCTTTGCTCTACACTGCTATGGG + Intergenic
1068930183 10:62581629-62581651 CCTCTGCTCTGCCTTGCTGTGGG + Intronic
1069725322 10:70573787-70573809 CATCTGCCCTGCCCTCCTTTAGG - Intergenic
1070349923 10:75582235-75582257 CCTTTGCACTGCCCTAGTAGAGG + Intronic
1070773182 10:79094569-79094591 CGTTGTCCCTGCCCTGCTGTGGG + Intronic
1072734144 10:97867666-97867688 CCTGTGCCCAGCCCTCCCATGGG - Exonic
1074798566 10:116975422-116975444 CCATTGCCCAGCCATGCTCTAGG + Intronic
1076405552 10:130210210-130210232 CCTTTCCCCTGACTTGCTCTAGG + Intergenic
1076569164 10:131421069-131421091 CCCAGGCCCTGCCCTCCTATTGG + Intergenic
1076883050 10:133248731-133248753 CCTGTGCCCTGGCCTCCTCTGGG - Intergenic
1077514482 11:2993085-2993107 CCTCTGCCCTGCTCTGCTTCAGG - Intergenic
1077606470 11:3616069-3616091 GCTTTGCCCTCCCCTGCTTTGGG - Intergenic
1078524431 11:12089811-12089833 CCTTCCCCCTGCCCTGCCACAGG - Intergenic
1079338802 11:19595225-19595247 CCTTTGACCTGCCCTGTCCTTGG + Intronic
1079707366 11:23637584-23637606 CCTTTGCACTGCCCTACTAAAGG + Intergenic
1081706020 11:45182230-45182252 CCTCTGCCCTGGCCAGCTCTAGG + Exonic
1081812494 11:45921937-45921959 CCCATTCCCTGGCCTGCTATGGG + Intronic
1082255293 11:50027356-50027378 CCTTTGCACTGCCCTAGTAGAGG - Intergenic
1082862104 11:57866728-57866750 TCTTTGCCCTGCCTTTCTGTGGG - Intergenic
1082993849 11:59233434-59233456 CCTTTGCCCTGGGCAGCTTTCGG - Intergenic
1083611303 11:64005729-64005751 CCTTTGCCCTGTCATGCTTTTGG + Intronic
1084592841 11:70100378-70100400 CCTCTGCCATTCTCTGCTATTGG - Intronic
1085034363 11:73291292-73291314 GCCTTGCCCTGCCCTGCCTTGGG + Intronic
1085452136 11:76640751-76640773 GTTTTGCCCTGCCCAGCTTTGGG + Intergenic
1087818315 11:102683354-102683376 CCTTTGTCCTTCCCTCCTAGGGG - Exonic
1089260374 11:117220084-117220106 CCTTTGCCCTGCCCTGCTATTGG - Intronic
1089614553 11:119687845-119687867 CCGATGCCCTGTCCAGCTATGGG + Intronic
1089787346 11:120917515-120917537 CCTTAGTCCTGCCCTGCTCGGGG - Intronic
1089938872 11:122394616-122394638 CTTTTGCCCCTCCCTGCAATGGG - Intergenic
1090023881 11:123151166-123151188 CCATGGCCCTGCCCTGGTAGTGG - Intronic
1090463001 11:126908540-126908562 CCTATGCCCTGCCCTGTTCTAGG - Intronic
1090740716 11:129657856-129657878 CCTTTGCCCTGCACAGCTCCTGG - Intergenic
1091388279 12:109005-109027 CCTTGGCCCAGCCCAGCTCTGGG + Intronic
1091836724 12:3591338-3591360 CCTTGGCCCAGACCTGCTGTAGG - Intronic
1091879941 12:3968800-3968822 CCTTTGCCATGGCCTGCTGGTGG - Intergenic
1092172665 12:6383704-6383726 CCGTTGTCCTGCCCTACTGTGGG - Intronic
1092670550 12:10856272-10856294 CCTTTGCACTGCCCTAGTAGAGG - Intronic
1093659369 12:21736619-21736641 CCTCTGCCCTATCCTGCTGTCGG - Intronic
1096803647 12:54127419-54127441 CCTTTTCCTTGCCCTCCTTTGGG - Intergenic
1098810619 12:75085575-75085597 CCTTTGCTCTTAACTGCTATAGG + Intronic
1099724790 12:86412147-86412169 CCTCTGCACTGCCCTGGTAGAGG - Intronic
1100623106 12:96299827-96299849 TCTTTGCCCTTTCCTACTATAGG + Intronic
1102049173 12:109849858-109849880 CCCTTGCCCTGCCCAGCCAAGGG + Intergenic
1103793573 12:123488483-123488505 CCTTCTCCCTGTGCTGCTATGGG - Intronic
1104405543 12:128513429-128513451 CCTTTGCCCTGCCCTCGTCAGGG + Intronic
1104887164 12:132117448-132117470 CCTCTGCACTGCCCTGTGATTGG - Intronic
1105805074 13:23947775-23947797 CCTTCACCCTGCCCTGCACTTGG + Intergenic
1106860455 13:33901983-33902005 CCTGACCCCTGCCCTGCTATGGG + Intronic
1108981801 13:56523600-56523622 CCTTTGCATTGCCCTGGTAGAGG + Intergenic
1110973867 13:81804678-81804700 CCTTTGCCCTTCCTTATTATGGG + Intergenic
1112089128 13:96064048-96064070 CCTTTCCCCTATTCTGCTATTGG - Intergenic
1112742937 13:102495496-102495518 CCTCTGCGCTGCCCTACTAGAGG + Intergenic
1113349213 13:109512123-109512145 CCTTTGGCCAACCCTGATATTGG - Intergenic
1114379760 14:22190160-22190182 GCTCTGCCCTGGCCTGCTGTGGG + Intergenic
1114389386 14:22290353-22290375 TCTTTCCCCTGGTCTGCTATGGG - Intergenic
1115519972 14:34223631-34223653 CTCTTGTCCTCCCCTGCTATTGG + Intronic
1118821519 14:69349195-69349217 CCTCGGCCCTGCCCTGCAGTGGG + Intronic
1119787808 14:77326058-77326080 CCTTTGCCCTTCCCTGAGATTGG + Intronic
1120583242 14:86279943-86279965 CCTCTGCACTGCCCTGGTAAAGG - Intergenic
1120634443 14:86934179-86934201 CCTTTTCCCTGCTCTGCGCTTGG - Intergenic
1121433608 14:93904178-93904200 CCTCTGCCCTGCACAGCTCTAGG - Intergenic
1122311922 14:100802914-100802936 GCATTGCCCTGCCCTGCTGGAGG + Intergenic
1122349478 14:101079085-101079107 GCTCTGCCCTGCCCTGCTCTCGG - Intergenic
1122407514 14:101509124-101509146 CCTCTGCCTGGCCCTGCCATGGG + Intergenic
1123121348 14:105918452-105918474 CCTTTGACCAGCTCTGCTGTGGG + Exonic
1124553483 15:30705324-30705346 CCTTTGCCCTGCTCTCTGATGGG - Intronic
1124637443 15:31374049-31374071 ACTCAGCCCTGCCATGCTATGGG + Exonic
1124677762 15:31700344-31700366 CCTTTGCCCTGCTCTCTGATGGG + Intronic
1125099979 15:35901287-35901309 CCTTGACCATGCCCTGTTATAGG + Intergenic
1129033730 15:72637366-72637388 CCCTTCCCCAGCCCTGCTGTGGG + Intergenic
1129216151 15:74099850-74099872 CCCTTCCCCAGCCCTGCTGTGGG - Intergenic
1129386704 15:75200465-75200487 CCCTGTCCCTGCCCTGCTAGTGG - Intronic
1129733302 15:77944209-77944231 CCCTTCCCCAGCCCTGCTGTGGG - Intergenic
1131028709 15:89168157-89168179 CCTTTGCCTTGTCCTTCTTTAGG + Intronic
1132819155 16:1853755-1853777 CCTGTGTCCTGCCCTGCTCCAGG + Intronic
1134440737 16:14298413-14298435 GCTTTGCCCTGCCCGCCTGTGGG - Intergenic
1135679635 16:24445331-24445353 CCGTTGCCCTGCGCGGCTTTTGG - Intergenic
1138561262 16:57802245-57802267 CCTCTGCCCGGACCCGCTATGGG - Intronic
1139365395 16:66429391-66429413 CCTATGCCCTGCTCTGCTCTGGG - Intronic
1139641042 16:68291607-68291629 CTGTTGCCCTGTCCTGCTTTGGG + Exonic
1139942159 16:70613117-70613139 CCTTCGACCGGCCCTGCTGTGGG - Intronic
1140564445 16:76025069-76025091 CCTCTGCTCTGCTCTGCTCTAGG - Intergenic
1140972188 16:80023990-80024012 CCTCTCCCCTGCCCAGCTGTGGG - Intergenic
1141633496 16:85301718-85301740 CCTCTGCCCTGCCCTGGGAGGGG - Intergenic
1142105953 16:88302869-88302891 CCTCTGCCCTGGCCAGCTGTGGG + Intergenic
1142276156 16:89119941-89119963 CCTTTGCCCTGGCCTGCGTCAGG - Intronic
1142766260 17:2065893-2065915 CCTGGGCCCTGCCCTCCTCTTGG + Intronic
1146129958 17:30263739-30263761 CCTTTGCCCAGCCCTGGCTTTGG - Intronic
1146289212 17:31596163-31596185 CCTCTGCCCTGCCCTGCCATAGG + Intergenic
1146759298 17:35462293-35462315 TCTTTTCCCTGCCTTCCTATGGG + Intergenic
1147232730 17:39030860-39030882 GCTTGGTCCTGGCCTGCTATTGG - Intergenic
1148365971 17:47056250-47056272 CCATTCCACTGCCCTGCTGTAGG + Intergenic
1148586610 17:48785780-48785802 ACTGTGCCCTGGCCTGCTAGAGG + Intronic
1149140601 17:53428587-53428609 CCTTTGCTCTGCCCTAGTATAGG - Intergenic
1150720096 17:67607127-67607149 TTTTTGCCCTGCGCTGCTGTAGG + Intronic
1151095667 17:71494927-71494949 CCTTTTCCCTGCCCTCCTGTGGG - Intergenic
1151373597 17:73666805-73666827 CCTAGGCCCTGCCCTGCTGAGGG + Intergenic
1151600912 17:75105453-75105475 CCTTTTCCCTGCCGTGTTATTGG + Intronic
1152225742 17:79091786-79091808 CCTTGGCCCTGCGGTGCTAAGGG + Intronic
1152630828 17:81410066-81410088 CAGTTGCCCTGCCCTGCTGGAGG + Intronic
1154176203 18:12088266-12088288 CCCTGGCCCTGCCCTGGTATTGG + Intergenic
1156251038 18:35352775-35352797 CCTTTGCACTGCCCTAGTACAGG - Intergenic
1156496349 18:37527818-37527840 ACTTTCCCCTGACCTTCTATAGG + Intronic
1160202385 18:76806559-76806581 CCTCTGCCCTGCCCTGCCCGGGG + Intronic
1161030530 19:2056066-2056088 GCCTGGCCCTGCCCTGCTGTGGG + Intergenic
1161030539 19:2056093-2056115 GCCTGGCCCTGCCCTGCTTTGGG + Intergenic
1161253764 19:3295152-3295174 CCCTTGCCCTGCCCCTCTACTGG + Intronic
1161313210 19:3606435-3606457 CGCTGGCCCTGCCCTGCTGTGGG - Intronic
1162941893 19:14015589-14015611 ACTTTGCCCTGCCTTGCTTGTGG + Intergenic
1165318811 19:35073910-35073932 CTTGTGCCCAGCCCTGCTAATGG + Intergenic
1165553426 19:36607691-36607713 CCTTTAACCTTCCCTGATATTGG + Intronic
1165913746 19:39245373-39245395 CACTAGCCCTGCCCTGCTCTGGG - Intergenic
1165917215 19:39268251-39268273 CACTAGCCCTGCCCTGCTCTGGG + Intergenic
1166217398 19:41344546-41344568 TCTCTGCCCTGCCCTGTGATGGG - Intronic
1166587307 19:43960900-43960922 CCTTGGCACTGCCCTGGTAGAGG - Intronic
1167802073 19:51750146-51750168 CCTCTGCCCTGCCACGCTACTGG + Intronic
924978146 2:196463-196485 ACTTTCCCCTGCCCTGTGATGGG - Intergenic
926251845 2:11159321-11159343 CCTCTGCCCTGCCCTGCCGCAGG - Intronic
927186721 2:20487404-20487426 CCTTTTCCCTGCACTGCCAGTGG - Intergenic
927579206 2:24226232-24226254 CCTTTTCCCTGTTCTGCTCTGGG + Intronic
928619968 2:33078784-33078806 CCTTTGCCCTCCTGTGTTATTGG + Intronic
931706117 2:64947855-64947877 CCTTTTCCCTGGCCTGGTATTGG + Intergenic
936042457 2:109160371-109160393 CTTTAGCCCTGCCCTGCTTTGGG - Intronic
936839302 2:116750872-116750894 CCTAAGCCATGCCCTGATATTGG + Intergenic
938076753 2:128343314-128343336 CCTTTGCCCTCCGCTTTTATTGG + Intergenic
938263757 2:129912097-129912119 CCCTTGCCCTGCCCTGCCCTAGG - Intergenic
939738508 2:145879377-145879399 CCTTTGCCCTGCTCTGTGACTGG + Intergenic
941063812 2:160878346-160878368 CCACTGCCCTGCCCTGCTTGTGG + Intergenic
942047129 2:172106331-172106353 GCTTTGCTCTGCCGGGCTATTGG + Intergenic
942135684 2:172923063-172923085 CCTTTGCCTTTCTCTGCTTTCGG + Intronic
943448977 2:188024428-188024450 CCTTTGCCATCCCCTTTTATTGG - Intergenic
945741819 2:213672751-213672773 CATTGGCCCTGCTCTGCAATAGG + Intronic
946183945 2:217966235-217966257 GCCTTGCCCCTCCCTGCTATGGG + Intronic
946237375 2:218332477-218332499 CCTGTGCCCTGCCCTGCCAAGGG - Intronic
946558521 2:220886845-220886867 CTTTTGTCCTTCCCTACTATTGG + Intergenic
947645051 2:231732709-231732731 CCTGTCCCCTGCCCTGGTCTGGG + Exonic
947747104 2:232513475-232513497 CCTCTGCCCAGCCCTGCCTTGGG - Intergenic
948225295 2:236305147-236305169 CCTTTGCCACGCCCTTTTATAGG + Intergenic
948691618 2:239707757-239707779 GCCTTGCCCTGCCCTGCCCTGGG + Intergenic
1170663246 20:18363050-18363072 CCTGTGTCCTGCCCTTCTCTGGG - Intergenic
1172358311 20:34294920-34294942 CCATTGCCCTACCCTGCTTTGGG + Intronic
1173081292 20:39870426-39870448 CCTTGGAACTGGCCTGCTATGGG + Intergenic
1175416455 20:58804453-58804475 CCTTCACACTGCCCTGCTAATGG - Intergenic
1175727893 20:61332011-61332033 CCTGTGCCTGGCCCTGCTCTGGG - Intronic
1179186236 21:39087244-39087266 GCTTTGCCTTGCCCAGCTGTGGG - Intergenic
1180700631 22:17779714-17779736 CCTTGGCCCTGAGCTGCTGTTGG - Intergenic
1180958293 22:19750870-19750892 GCCCTGCCCTGCCCTGCCATGGG + Intergenic
1181030222 22:20145939-20145961 CTTCTGCCCTGGCCTGCTCTGGG + Intronic
1181688446 22:24544720-24544742 ACTGTGCCCAGCCCTGCTCTAGG - Intronic
1182430323 22:30295263-30295285 CCTCTGCCCTCCCCTGTCATGGG - Intronic
1183734440 22:39636045-39636067 CCTGTGCCAAGCCCTGCTCTAGG - Intronic
1185276332 22:49951566-49951588 CCTTGGCCCTGCCCTCCCCTGGG - Intergenic
950529281 3:13543745-13543767 GCTTTTCCCTGCCCTTCTAGAGG - Intergenic
951538627 3:23761941-23761963 CCTTTGACCTGCCTTCCTCTGGG - Intergenic
951888461 3:27547293-27547315 CCTGTGCCATGCCCTGGTTTAGG + Intergenic
952191390 3:31026704-31026726 CCTATGCCATGCTCTGCTCTAGG - Intergenic
953922014 3:46958661-46958683 CCTTTGCCCTGCCCTTATCTTGG - Intronic
954301423 3:49702688-49702710 TCTCTGCCCTGCGCTACTATTGG + Exonic
954610579 3:51942729-51942751 GCCTTGCCCTGCCCTGCCGTGGG - Intronic
954775135 3:53010330-53010352 CCTTTGTCCTCCCCTGGGATAGG - Intronic
956210315 3:66795669-66795691 CCGATGCCCTGCCCTGCCCTGGG + Intergenic
956268156 3:67421446-67421468 TCTTCGCTCTGCCCTGCTTTAGG + Intronic
956349582 3:68320340-68320362 TCATTGCCCTGCTCTGCTCTGGG + Intronic
958711436 3:97721756-97721778 CCTTTGCTCTTCCCTGCCATTGG + Intronic
959171348 3:102847935-102847957 CCTTTGCACTGCCCTAGTAGAGG + Intergenic
960685513 3:120289909-120289931 CCTGAGCCCTGCCCTGCGGTGGG - Intergenic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
961485349 3:127211991-127212013 ACATTGCCCAGCCCTGCTACAGG - Intergenic
961823424 3:129586752-129586774 GGTTTGGCCTCCCCTGCTATGGG - Intronic
966474837 3:180332108-180332130 CCTCTGCCATGCCCTAATATGGG + Intergenic
969322658 4:6422207-6422229 CCATTTCAGTGCCCTGCTATTGG - Intronic
969618527 4:8267431-8267453 CCTTTGCTCTTCCCTGAAATGGG - Intergenic
973032534 4:45361823-45361845 CCTCTGCCCTGCCCTAGTAGAGG - Intergenic
973099522 4:46247456-46247478 CCTGTGCCATGCCCTGTAATTGG - Intergenic
974443451 4:61948705-61948727 CCTTTGCACTACCATGCTCTGGG - Intronic
977255197 4:94732705-94732727 CCTTTCCCCTCCCCTGTTCTGGG - Intergenic
977783438 4:101005953-101005975 CCTCTGCACTGCCCTGTTAGAGG - Intergenic
978842369 4:113229722-113229744 TCTTTGCCCTGCCCAGCCAGAGG + Intronic
980756795 4:137174904-137174926 ACTTTGCCCTGGCCTCTTATAGG - Intergenic
980885560 4:138758750-138758772 CCTTTGCCCTGCCCTGATTCTGG - Intergenic
982093034 4:151896870-151896892 GCTTTGCACTGGCCTGGTATTGG - Intergenic
982112167 4:152066748-152066770 CTTTCTCCCTGCCCTGCTGTAGG - Intergenic
985493228 5:191222-191244 TCTCTGCCCAGCCCTGCCATGGG + Intergenic
985913777 5:2902503-2902525 CCATTGTCCTGCCCTGCTCAGGG + Intergenic
986729730 5:10626236-10626258 CCTCTTCCTTGCCCTGCTTTCGG - Intronic
990449921 5:55924538-55924560 CTTTTGCCCTGCCCAGCTCCTGG - Intergenic
993190142 5:84670622-84670644 CCTTCACACTGCCCTGGTATAGG - Intergenic
994099350 5:95877163-95877185 CCATTGCCCTGCTCTGCTCTGGG - Intergenic
994936071 5:106255309-106255331 CCTTTGCACTGCCCTAGTAGAGG - Intergenic
996169178 5:120267465-120267487 ACTTTGCCCCCCACTGCTATGGG - Intergenic
998368069 5:141644060-141644082 CCTTTTCCCTGCCCCCCCATAGG + Intronic
998413686 5:141929952-141929974 CCTTTGCCCTGGCCGGGTGTCGG + Intronic
1002392781 5:178928819-178928841 CCTCTGCACTGCCCTAGTATAGG + Intronic
1002794014 6:456301-456323 CTTTTGCACTGCCCTGGTAGAGG + Intergenic
1003302289 6:4894383-4894405 GCTTGGCCCTGCCCTGCTCCTGG + Intronic
1004418422 6:15446302-15446324 CCATTGCTCTGCCCTTCTGTTGG - Intronic
1005707588 6:28470645-28470667 CCTGTGCCCTGCCATGGTGTGGG - Intergenic
1005905975 6:30261524-30261546 CCTCAGCCCTGCCCTGCTGAAGG - Intergenic
1007369280 6:41415565-41415587 CCTGTGCCAGGCCCTGCTGTGGG + Intergenic
1007821428 6:44563218-44563240 CCCTTTCCCAGCCCTGCTGTGGG - Intergenic
1009658555 6:66578608-66578630 CCATTTCCCTGCCCTGCCCTTGG + Intergenic
1010268309 6:73892036-73892058 GCTTTCCCCTGCAGTGCTATAGG + Intergenic
1011517080 6:88166405-88166427 CCTTTGTCCTGCCCTGGCAGCGG + Intergenic
1012585746 6:100920160-100920182 TCTTTGCCCTGTCTTGTTATAGG + Intergenic
1013355057 6:109339349-109339371 CCTGTCCCCTTCCCTGCTATTGG + Intergenic
1013603171 6:111724250-111724272 CCTTTCTGCTGCCATGCTATGGG + Intronic
1013614113 6:111825679-111825701 CCTTTGCCCTGACCTGTTTGGGG + Intronic
1014444736 6:121514195-121514217 CCTGTGCCCTGCCCAGCAATCGG - Intergenic
1017301060 6:152858519-152858541 GCTTTGCCATCTCCTGCTATTGG - Intergenic
1017333130 6:153222702-153222724 CCTTTGCCCTACCCTCATACAGG - Intergenic
1018112010 6:160545264-160545286 CCTTGAACCTGCCCTACTATTGG - Intronic
1018297817 6:162368047-162368069 CCTTTCCCCTGACCTGCCTTTGG + Intronic
1019180077 6:170181215-170181237 GCTCTGCCCTGCCCTGCTGGAGG - Intergenic
1019272213 7:156655-156677 CCTCTGCCCTGCCCTGGTCCTGG + Intergenic
1019355098 7:574293-574315 CCCCTGCCCTGCCCTGCTCTCGG - Intronic
1019508182 7:1403882-1403904 GCTCTGCCCTGCTCTGCCATTGG - Intergenic
1020398577 7:7747390-7747412 CATTTGCCCTGCCTTGTTCTAGG - Intronic
1020546627 7:9541089-9541111 CCTTTGCACTGCCCTAGTAGAGG - Intergenic
1021930608 7:25577699-25577721 CCTTTGCCCTGCTCAGCTGCAGG + Intergenic
1022626426 7:32041328-32041350 TCTTTGCCCTGCCATGAAATTGG - Intronic
1024096258 7:45985194-45985216 GCTCTGCCCTGCCCAGCTATGGG + Intergenic
1025246724 7:57323182-57323204 CCTCTGCCCAGGCCTGCTGTGGG - Intergenic
1029046654 7:97636409-97636431 CCTGTCGCCTGCCCTACTATCGG + Intergenic
1029364338 7:100107424-100107446 CCTTTGCCCTCCCCTGTTGGGGG + Exonic
1030503301 7:110387017-110387039 CCTTTGCTCTTCCCTGCACTGGG - Intergenic
1030862813 7:114658033-114658055 CCTTTTTCCTGCCCTTCTCTTGG + Intronic
1034122605 7:148641063-148641085 CCTTTGCCTTCCCCTGCCTTGGG + Intergenic
1035346420 7:158202583-158202605 CCCTTCCCCTGCCCTGCTATGGG - Intronic
1037746587 8:21650288-21650310 CCTTTGCATTGCCCTGGTAGAGG + Intergenic
1038360742 8:26873478-26873500 CCTTTGCCCTGCTTTGCCATTGG - Intergenic
1041103333 8:54418205-54418227 ACCCTGCCCTGCCCTGCTCTAGG - Intergenic
1042002544 8:64141852-64141874 CCTTTGCCTTCTACTGCTATTGG + Intergenic
1042412105 8:68477652-68477674 CCTTTGCACTGCCCTAGCATAGG + Intronic
1043511038 8:80950529-80950551 ACCTTTCCCTGCTCTGCTATGGG + Intergenic
1044398754 8:91744818-91744840 CCTTTGCTTTTCCCTGCTTTCGG + Intergenic
1044822236 8:96162020-96162042 GCTCTGCCCTGGACTGCTATGGG + Intergenic
1045188679 8:99862694-99862716 CCTTTGCTCTGCACTGCTTTGGG - Intronic
1045640857 8:104248761-104248783 CCTTGGCCCTGCTCAGCTAGTGG + Exonic
1047174218 8:122525129-122525151 CCTTCCTCCTGCCCTGCAATAGG - Intergenic
1047448136 8:124938006-124938028 CCTCTACCCTGGCCTGCTCTGGG + Intergenic
1048293318 8:133196802-133196824 GAATTCCCCTGCCCTGCTATTGG - Intronic
1049175609 8:141190692-141190714 CTTTTGCTGTGCCCTGCTCTGGG + Intronic
1049990047 9:981907-981929 CCTTTCCCTTGCCCAGCTCTTGG + Intronic
1050939347 9:11439732-11439754 CCTTTGCACTGCCCTAGTAGAGG - Intergenic
1053466544 9:38312568-38312590 ACTTTGCTCTGCCCAGCTGTGGG + Intergenic
1053612901 9:39733238-39733260 CCTTTGGGCTGGGCTGCTATTGG + Intergenic
1053870941 9:42491180-42491202 CCTTTGGGCTGGGCTGCTATTGG + Intergenic
1054554748 9:66643686-66643708 CCTTTGGGCTGGGCTGCTATTGG - Intergenic
1055160341 9:73119076-73119098 CCCTTGCCCTGACCTGCAACTGG - Intergenic
1058672724 9:107374174-107374196 CCTTTGCCCTCCCCTGCCCAGGG - Intergenic
1058902773 9:109456618-109456640 CCTCTGCCCTGATCTGCTCTCGG - Intronic
1060293946 9:122330404-122330426 CTTTTGCCCTGCCCTCCCCTAGG - Intergenic
1060968388 9:127724254-127724276 ACTTTGCCGTGCACTGCTACAGG + Exonic
1060970921 9:127737356-127737378 CCTATCCCCTGCCCTGCCCTGGG - Intergenic
1061505492 9:131029551-131029573 TCTTTGTCCTGCTCTGCTCTTGG - Intronic
1062018920 9:134307081-134307103 CCTGGGCCTTGTCCTGCTATGGG + Intergenic
1185518132 X:715912-715934 CCTGTGCAATGCCCGGCTATTGG + Intergenic
1187664559 X:21591024-21591046 CTTTTGCTCTTGCCTGCTATAGG - Exonic
1189316445 X:40060401-40060423 CCTTAGTCCAGGCCTGCTATAGG + Intronic
1190626686 X:52343994-52344016 CCTGTGCCCAGCACTGCTCTCGG - Intergenic
1190701325 X:52991835-52991857 CCTGTGCCCGGCACTGCTCTCGG + Intronic
1193143513 X:78054309-78054331 CCTTTGCACTGCCCTAGTAGAGG + Intergenic
1195077359 X:101339779-101339801 CCTATTCCCAGCCCTGCTAGAGG + Intergenic
1195211453 X:102654893-102654915 CCTGTGCCTGGCCCTGTTATTGG - Exonic
1198078269 X:133214730-133214752 CCTTTGCCCTGCCTTCCCCTTGG - Intergenic
1199664297 X:150084254-150084276 GCTTTGCCCTGCCTTGCTCTTGG + Intergenic