ID: 1089260707

View in Genome Browser
Species Human (GRCh38)
Location 11:117222081-117222103
Sequence CTGAGTCGGGAGATCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089260707_1089260713 4 Left 1089260707 11:117222081-117222103 CCCAGAGAGATCTCCCGACTCAG 0: 1
1: 0
2: 1
3: 2
4: 93
Right 1089260713 11:117222108-117222130 TGGAGAAATTTGATACCACCTGG 0: 1
1: 0
2: 3
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089260707 Original CRISPR CTGAGTCGGGAGATCTCTCT GGG (reversed) Intronic
900185657 1:1331992-1332014 CTGTGTCAGGAGATGCCTCTTGG + Intronic
902169725 1:14599624-14599646 CAGAGCCCGGAGCTCTCTCTGGG - Intronic
903994138 1:27294788-27294810 CTGAGCTAGGACATCTCTCTGGG - Intronic
906279543 1:44543774-44543796 CTGTGGGGGGAGATATCTCTGGG + Intronic
908393489 1:63704329-63704351 GTCAGTCATGAGATCTCTCTTGG + Intergenic
912282231 1:108327903-108327925 ATGACCTGGGAGATCTCTCTTGG + Intergenic
920423287 1:205850515-205850537 CTGGGGCGGGGGAGCTCTCTAGG + Intergenic
920929806 1:210376691-210376713 CTGGGTGGGGAGGTGTCTCTTGG + Intronic
1070601137 10:77867178-77867200 CTGAGTAGGAAGATATTTCTTGG - Intronic
1072251257 10:93584015-93584037 CTGAGTAAGGATATCGCTCTAGG - Intronic
1072430979 10:95370130-95370152 CTGGGGCTGGAGATCTGTCTTGG + Intronic
1074722466 10:116274236-116274258 CTGGGTCGGGAGACCGGTCTAGG + Intergenic
1076564709 10:131390236-131390258 CTGAGCCCTGAGATCTCTCTAGG + Intergenic
1076921468 10:133456681-133456703 GTGGGTCTGGAGCTCTCTCTGGG + Intergenic
1083305643 11:61760844-61760866 TTGACTCTGGAGGTCTCTCTGGG + Intronic
1086794853 11:91087410-91087432 CTGAGTCTGTAGATCACTTTGGG + Intergenic
1089260707 11:117222081-117222103 CTGAGTCGGGAGATCTCTCTGGG - Intronic
1097818623 12:64103703-64103725 CTGAGTAGGTAAAGCTCTCTAGG + Intronic
1097895873 12:64824626-64824648 CTGAGGCAGGAGATCGCTCGAGG - Exonic
1098114499 12:67160789-67160811 CTGAGTCTGTAGATTTCCCTCGG + Intergenic
1099230579 12:80019294-80019316 CAGAGCCAGGAGATCTCTATTGG + Intergenic
1100479756 12:94966509-94966531 CTGAGGCGGGTGATCTCTTGAGG + Intronic
1102338636 12:112104085-112104107 CTGAGTTAGGACATTTCTCTTGG - Intronic
1104108443 12:125684947-125684969 CTGAGTCAGGAGTACTCACTAGG + Intergenic
1107680843 13:42848430-42848452 CTGACTAGTGACATCTCTCTTGG + Intergenic
1119164779 14:72483214-72483236 ATGGGTCGGGAGAAGTCTCTGGG - Intronic
1120152473 14:81052608-81052630 CTGAATCTGGAGATCACTTTGGG + Intronic
1120626761 14:86837029-86837051 CTGCTTCTGCAGATCTCTCTTGG + Intergenic
1128815504 15:70605370-70605392 CTGAGTAGGGAGATTGCTTTGGG - Intergenic
1136450467 16:30351781-30351803 CTGACTCAGGGGCTCTCTCTCGG + Exonic
1137339840 16:47590765-47590787 CACAGTCAGGAGATCTTTCTTGG + Intronic
1138457976 16:57132227-57132249 CTGGGGCAGGAGTTCTCTCTGGG - Intronic
1141415824 16:83872728-83872750 CTGAATCTGTAGATCTCTTTGGG + Intergenic
1144033308 17:11341565-11341587 CTGAGGCGGGAGATCACTTGAGG - Intronic
1145001182 17:19305792-19305814 CTGAGTTGGGAGAGTTTTCTTGG + Intronic
1146456648 17:33014384-33014406 CTGAGTCCTGACCTCTCTCTTGG + Intronic
1149862708 17:60132449-60132471 CTAAGTCACGTGATCTCTCTGGG + Intergenic
1151152657 17:72101136-72101158 CTGAGGCCTGAGCTCTCTCTTGG + Intergenic
1151769001 17:76147451-76147473 CAGAGTCAGGACAGCTCTCTGGG - Intronic
1152445745 17:80342029-80342051 CTGAGGCGGGTGATCACTCAAGG - Intronic
1158306008 18:56106326-56106348 CTGAGTTGGCAGCTCTCTGTGGG - Intergenic
1158755875 18:60324525-60324547 CTGAATCTGTAGATTTCTCTGGG + Intergenic
1160319235 18:77875009-77875031 CTGCGTGGGGAGGTCTGTCTGGG - Intergenic
1161644240 19:5443508-5443530 CTGAGTCAGGTGCTCCCTCTGGG - Intergenic
1166674609 19:44732349-44732371 CTGAGTCAGGAGCCCCCTCTGGG - Intergenic
1166868163 19:45853721-45853743 CTGGGTCAGGAGCTCCCTCTGGG + Intronic
925020513 2:564376-564398 CTGAATCTGGGGATATCTCTGGG + Intergenic
925068149 2:945599-945621 CTGAGTCTGTAGATCACTTTGGG + Intergenic
926186816 2:10697056-10697078 CTGAGGCGGGAGATCGCTTGAGG + Intergenic
931738554 2:65220901-65220923 CTGAGTGGGGAGATCACTTGAGG + Intergenic
936829210 2:116621706-116621728 CTGAATCTGTAGATTTCTCTGGG - Intergenic
937568439 2:123326899-123326921 CTGAATCTGTAGATCACTCTTGG - Intergenic
948386929 2:237586258-237586280 CTGAGTTGGGAGCTCTGTATTGG - Intronic
948873871 2:240817408-240817430 CAGAGTCTGGGGACCTCTCTAGG - Intronic
1170734461 20:19002231-19002253 CTCAGTCTGGAAATGTCTCTAGG - Intergenic
1171499253 20:25580443-25580465 CTGAAACAGGAGAGCTCTCTAGG - Intronic
1181178621 22:21052215-21052237 GTGAGTCAGAAGGTCTCTCTTGG + Intronic
1181616358 22:24057366-24057388 CTGAGTGGAGAGGCCTCTCTCGG + Intronic
1183554715 22:38516260-38516282 CTAAGGCTGGAAATCTCTCTGGG - Intergenic
1184533097 22:45069508-45069530 CTGAGTCAGGGGCTCTCTCTGGG + Intergenic
952416154 3:33093053-33093075 CCGAGCCTGGAGAGCTCTCTTGG + Exonic
954289531 3:49642420-49642442 CTGGGCCCCGAGATCTCTCTTGG - Exonic
967152928 3:186666238-186666260 CTGAGTTGGGAGATTACTCACGG + Intronic
967223894 3:187273262-187273284 CTGGGCTGGGAGGTCTCTCTAGG - Intronic
971276796 4:25205980-25206002 CTGAGTTGGGAGATCACTTAAGG - Intronic
973273890 4:48288739-48288761 CTGGGTCTGGAGATTTCTTTTGG - Intergenic
975992157 4:80268235-80268257 AGGAGTGGGGAGATCTCTGTGGG + Intronic
976068734 4:81218044-81218066 CAGAGTCGGGAAATCGTTCTTGG + Intergenic
980972706 4:139581746-139581768 CTGTGCTGGGGGATCTCTCTAGG + Intronic
991003435 5:61805415-61805437 CTGAATCTGGAGATCCTTCTTGG - Intergenic
999095055 5:148970302-148970324 CTGAGTCTGGCAATCTCTCCTGG + Intronic
1002607975 5:180394486-180394508 CTGAGTTGGGAGAGGCCTCTAGG + Intergenic
1007663063 6:43498116-43498138 CTGAGGCCAGAGAGCTCTCTTGG + Intronic
1007711290 6:43825926-43825948 CTGAGCCGGGAGAAGTCCCTGGG - Intergenic
1011072104 6:83396545-83396567 CTGAATCTGTAGATCTCTTTGGG - Intronic
1017932116 6:158965349-158965371 TTGAATCTGGAGATCACTCTGGG + Intergenic
1024371671 7:48591542-48591564 CTGAGTCTGTAGATCGCTTTGGG + Intronic
1024993068 7:55251421-55251443 CTGAGTGGAGAGATCTCTCTGGG + Intronic
1025078587 7:55964073-55964095 CTGAGGCCGGAGATCTCTTGAGG - Intronic
1026255639 7:68708952-68708974 CTGAGTCTGGAGACAGCTCTGGG - Intergenic
1028018087 7:85739854-85739876 CTGACTTTGGAGATCTCTATAGG + Intergenic
1037327242 8:17704831-17704853 CTGAATCTGTAGATCTCTTTGGG + Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040616766 8:49045259-49045281 CTGAATGCGGAGAGCTCTCTGGG + Intergenic
1041206441 8:55503251-55503273 CTGAGTCTGTAGATCACTTTGGG + Intronic
1042565366 8:70105038-70105060 CTGAGCCGGGAGACATCTGTGGG + Intergenic
1042686244 8:71444029-71444051 CTCAGTCGGTAGATCTTTATAGG - Intronic
1044335898 8:90984962-90984984 GTGGGTCGGGAAATCTCTCAGGG - Intronic
1046423882 8:114020379-114020401 CTGAGGCGGAAGATCTCTTCAGG - Intergenic
1052358343 9:27528723-27528745 CTGCGTAGAGAGATCTCTGTGGG + Intronic
1052613857 9:30812828-30812850 CTGTGTCTGATGATCTCTCTTGG - Intergenic
1059138615 9:111831190-111831212 ATAAGTCTGTAGATCTCTCTGGG + Intergenic
1062057920 9:134478202-134478224 CTGAGTCTGGTGGCCTCTCTAGG + Intergenic
1062427155 9:136511309-136511331 CCGATTTGGGAGATCCCTCTGGG - Intronic
1187239462 X:17499542-17499564 CTGTGTCGGGTGCTGTCTCTCGG - Intronic
1190358413 X:49627033-49627055 CTGGGACGGGCGATCCCTCTGGG + Intergenic
1191970440 X:66809278-66809300 TTGAATCGGTAGATCTCTGTAGG - Intergenic