ID: 1089262398

View in Genome Browser
Species Human (GRCh38)
Location 11:117232141-117232163
Sequence CGCGGGGGTCGCCGGGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 322}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089262398_1089262414 15 Left 1089262398 11:117232141-117232163 CCTGCGGCCCGGCGACCCCCGCG 0: 1
1: 0
2: 4
3: 33
4: 322
Right 1089262414 11:117232179-117232201 CGCCCGGGGTCCGGCTCCCGCGG 0: 1
1: 0
2: 4
3: 17
4: 183
1089262398_1089262415 16 Left 1089262398 11:117232141-117232163 CCTGCGGCCCGGCGACCCCCGCG 0: 1
1: 0
2: 4
3: 33
4: 322
Right 1089262415 11:117232180-117232202 GCCCGGGGTCCGGCTCCCGCGGG 0: 1
1: 0
2: 2
3: 26
4: 196
1089262398_1089262410 1 Left 1089262398 11:117232141-117232163 CCTGCGGCCCGGCGACCCCCGCG 0: 1
1: 0
2: 4
3: 33
4: 322
Right 1089262410 11:117232165-117232187 GCCACAGCAACCGGCGCCCGGGG 0: 1
1: 0
2: 1
3: 2
4: 130
1089262398_1089262404 -8 Left 1089262398 11:117232141-117232163 CCTGCGGCCCGGCGACCCCCGCG 0: 1
1: 0
2: 4
3: 33
4: 322
Right 1089262404 11:117232156-117232178 CCCCCGCGGGCCACAGCAACCGG 0: 1
1: 0
2: 0
3: 11
4: 89
1089262398_1089262418 19 Left 1089262398 11:117232141-117232163 CCTGCGGCCCGGCGACCCCCGCG 0: 1
1: 0
2: 4
3: 33
4: 322
Right 1089262418 11:117232183-117232205 CGGGGTCCGGCTCCCGCGGGCGG 0: 1
1: 0
2: 2
3: 14
4: 172
1089262398_1089262408 -1 Left 1089262398 11:117232141-117232163 CCTGCGGCCCGGCGACCCCCGCG 0: 1
1: 0
2: 4
3: 33
4: 322
Right 1089262408 11:117232163-117232185 GGGCCACAGCAACCGGCGCCCGG 0: 1
1: 0
2: 1
3: 13
4: 188
1089262398_1089262412 6 Left 1089262398 11:117232141-117232163 CCTGCGGCCCGGCGACCCCCGCG 0: 1
1: 0
2: 4
3: 33
4: 322
Right 1089262412 11:117232170-117232192 AGCAACCGGCGCCCGGGGTCCGG 0: 1
1: 0
2: 0
3: 1
4: 67
1089262398_1089262409 0 Left 1089262398 11:117232141-117232163 CCTGCGGCCCGGCGACCCCCGCG 0: 1
1: 0
2: 4
3: 33
4: 322
Right 1089262409 11:117232164-117232186 GGCCACAGCAACCGGCGCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 154
1089262398_1089262420 29 Left 1089262398 11:117232141-117232163 CCTGCGGCCCGGCGACCCCCGCG 0: 1
1: 0
2: 4
3: 33
4: 322
Right 1089262420 11:117232193-117232215 CTCCCGCGGGCGGCCTACGCAGG 0: 1
1: 0
2: 0
3: 7
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089262398 Original CRISPR CGCGGGGGTCGCCGGGCCGC AGG (reversed) Exonic
900113880 1:1020510-1020532 AGGGGGGGTCGCCGGGTCCCGGG + Intronic
900173354 1:1281265-1281287 CGCTGAGGTGGCCGGGCCACAGG - Exonic
901373067 1:8817244-8817266 CGCGGAGGCTGCGGGGCCGCGGG + Exonic
901602144 1:10430667-10430689 CGCGGGGGGCGCCCGGGGGCGGG - Intronic
903468483 1:23568489-23568511 CGCCGGGGCCGCAGGGACGCTGG - Intergenic
904005417 1:27360875-27360897 CGCGGAGGGCGAGGGGCCGCGGG - Intronic
904106429 1:28088752-28088774 GGCGTGGCTCGCCGGGCCGGCGG - Intergenic
904181368 1:28668899-28668921 CGCGGGGGCCGCGCGGCGGCCGG + Intronic
904542009 1:31239639-31239661 CGCTGGGCGCGCCGGGCGGCGGG + Intergenic
905058647 1:35120935-35120957 CCTGGGGGTCGCCGTGCGGCGGG - Intergenic
905399564 1:37691842-37691864 GGCGGGAGTGGCCGGCCCGCGGG + Intronic
907767355 1:57424142-57424164 CGCGGGGGGCGGCGGGGCGGGGG - Intronic
912490327 1:110059245-110059267 GGTGGGGGTGGCCGGGCTGCTGG + Intronic
914758319 1:150579249-150579271 CGCGGGGGTCGCGGTGACGTCGG + Exonic
914869128 1:151458825-151458847 CGCGGCGGGCGCCGGGGGGCGGG + Intronic
916535374 1:165698597-165698619 CGCGGGAGGGGCGGGGCCGCGGG + Exonic
916535383 1:165698614-165698636 CGCGGGAGGGGCGGGGCCGCGGG + Exonic
916667036 1:166975731-166975753 CGCGGGGGAGGCCGCCCCGCGGG + Intronic
919772483 1:201171305-201171327 CGCGGGGGTGCACTGGCCGCTGG + Intronic
921039540 1:211416675-211416697 CGCCGGGGGCCCCGGGCGGCCGG + Intergenic
922558302 1:226549304-226549326 CGCTGGGGTCTCCGACCCGCAGG + Intronic
924527075 1:244863059-244863081 CGCGGGGAGCGCGGGCCCGCGGG - Intronic
1062843853 10:689891-689913 CGCGCGCGTCACGGGGCCGCGGG + Intergenic
1063115576 10:3069133-3069155 CGCGGGGGGCGCTGGGCCTGGGG - Intronic
1063636578 10:7788219-7788241 CGCGGGTGTCGCTGGGCTGTCGG + Exonic
1067980032 10:51074295-51074317 CGCGGTGGGCGCCGCGGCGCGGG - Exonic
1069962723 10:72087929-72087951 CTGGGGGGTCCCAGGGCCGCCGG + Intronic
1072003491 10:91220557-91220579 CGGGGGCGTGGCCGGGCGGCGGG + Intronic
1073059405 10:100724463-100724485 GGCGGGGCTTGGCGGGCCGCGGG + Intergenic
1073325846 10:102643732-102643754 CGGCGGGGGCGCCGGGCCTCGGG + Intergenic
1075999841 10:126905726-126905748 CGCCGGGGGCGCGGGGCGGCCGG - Intronic
1076992945 11:285035-285057 CGTGGGGGTGGCCGGGCTGCGGG - Intronic
1076992959 11:285074-285096 CGTGGGGGCAGCCGGGCCGCGGG - Intronic
1077049488 11:560470-560492 CGCAGGGGTCGCGGGGTCGCAGG - Intronic
1077100343 11:819693-819715 GGCGGCGGCCGCCGGGCCCCGGG - Exonic
1077505639 11:2928862-2928884 CGCAGGGCTCGCCGGGACGCGGG + Intronic
1078594624 11:12675104-12675126 CGCGGGGGGCGCGGCGCGGCCGG - Intronic
1078823327 11:14905019-14905041 CCCGGGGTCCGCCGGTCCGCGGG - Intronic
1081700018 11:45146950-45146972 CGCGGGGGCCGCCGGTGCGGGGG + Intronic
1084265665 11:68003992-68004014 GGCGGGGGCTGCGGGGCCGCAGG - Exonic
1084310194 11:68312450-68312472 CGCTGGGGCCGCCTGGCCGCCGG + Intergenic
1084517151 11:69643260-69643282 CGCGGGGGGCGGGGGGCGGCGGG - Intronic
1084814828 11:71639809-71639831 CGCGGGGGTGCCGGGGACGCGGG + Intergenic
1086361848 11:86068598-86068620 CGCGCGGGTCGCGCGGGCGCCGG + Intronic
1089262398 11:117232141-117232163 CGCGGGGGTCGCCGGGCCGCAGG - Exonic
1091616082 12:2052564-2052586 CGCGGGGGGCGCGACGCCGCCGG + Intronic
1092462438 12:8698214-8698236 AGCGCGGGCCGCCGGGCGGCTGG - Exonic
1096116877 12:49060159-49060181 CGCGGGGCCGGCGGGGCCGCGGG + Intergenic
1096495468 12:52037187-52037209 GGCGGGGGGCGCCGCGCGGCCGG + Intronic
1096870381 12:54588752-54588774 TGCGGGGGTCACCGCCCCGCGGG + Intergenic
1097891448 12:64781106-64781128 GGCGGGGGCCGCGGGGCCGAGGG + Intergenic
1103308848 12:119989090-119989112 CGCGGGATTCGCCGGCTCGCGGG - Intergenic
1103325312 12:120116527-120116549 CGCGGGGGCCTCGGGGCGGCAGG - Intronic
1103400802 12:120641422-120641444 CGTGGGGGACCACGGGCCGCGGG - Intronic
1103764430 12:123271001-123271023 CCCTGAGGTCGCGGGGCCGCCGG - Intronic
1103856011 12:123972241-123972263 CGCGGGGGTCGCCGAGCCTCAGG + Intronic
1104008960 12:124915270-124915292 CGGGGGGCTCCCGGGGCCGCGGG + Exonic
1104782945 12:131433168-131433190 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104782966 12:131433230-131433252 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104782977 12:131433261-131433283 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104782988 12:131433292-131433314 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783010 12:131433354-131433376 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783021 12:131433385-131433407 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783046 12:131433456-131433478 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783057 12:131433487-131433509 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783068 12:131433518-131433540 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783079 12:131433549-131433571 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783090 12:131433580-131433602 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783101 12:131433611-131433633 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783112 12:131433642-131433664 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783123 12:131433673-131433695 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783134 12:131433704-131433726 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783145 12:131433735-131433757 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783156 12:131433766-131433788 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783167 12:131433797-131433819 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783178 12:131433828-131433850 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783189 12:131433859-131433881 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783200 12:131433890-131433912 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783225 12:131433961-131433983 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783236 12:131433992-131434014 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783247 12:131434023-131434045 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783258 12:131434054-131434076 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783269 12:131434085-131434107 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783280 12:131434116-131434138 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783291 12:131434147-131434169 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783302 12:131434178-131434200 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783313 12:131434209-131434231 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104783324 12:131434240-131434262 CGCGGGGGATGCCGGGACACAGG - Intergenic
1104857245 12:131907996-131908018 CGCGGGGGTGGGTGGGGCGCCGG + Intronic
1105270901 13:18874969-18874991 CGCGGTGGCCGCCGGGCTCCCGG + Intergenic
1105378069 13:19863212-19863234 GGCGGAGGTCGCGGGGCCGGCGG - Intronic
1105389191 13:19959153-19959175 GGCGGGGGTCGCGGGGCCGGCGG + Intronic
1106157620 13:27172154-27172176 CGCGGGGGTCTCTGGGTCCCCGG - Intergenic
1106925354 13:34607657-34607679 GGCGGGGGTCACCGGGGTGCAGG - Intergenic
1110318641 13:74135703-74135725 CGCGGGGCGGGCCGGGCCGGGGG - Intergenic
1111396074 13:87671841-87671863 CGCGGTGGTCGCCGCTGCGCTGG + Intergenic
1113914668 13:113863390-113863412 CGCGGGGATCCCGGGGTCGCCGG + Intronic
1115576243 14:34714673-34714695 GGCGGGGCTCGGCGGGCCGCAGG + Exonic
1115855051 14:37622231-37622253 CGCGGGGCGGGCCGGGCCGGGGG - Intronic
1116820297 14:49620891-49620913 CGCAGAGGACGCAGGGCCGCTGG + Exonic
1117029184 14:51651756-51651778 CGCGGCGGCAGCCGAGCCGCGGG - Intronic
1118845986 14:69548184-69548206 GGCTGGGGTCCCTGGGCCGCGGG + Intergenic
1119622125 14:76138967-76138989 CGCGGGGGGCGGCGCGGCGCCGG + Intergenic
1121325837 14:93019172-93019194 CGCAGGGGGAGCCGGGCCACAGG + Intronic
1121368033 14:93332674-93332696 CGCGGGAGGCGCTGGGGCGCCGG - Intronic
1122140340 14:99659764-99659786 GGCCGGGGTCCCCGGGGCGCGGG - Intronic
1122217677 14:100214631-100214653 CGCGGGGGACGAGGGGCCCCGGG - Intergenic
1122620829 14:103056951-103056973 CGCGGGGGTCGCAGAGCCGCAGG + Intronic
1122978569 14:105181101-105181123 CGCGGGGGACGCGGGGGCGCGGG + Intronic
1123047485 14:105526174-105526196 CGCGGGGCTGGCCTGGCCGCCGG - Intergenic
1123490409 15:20775717-20775739 CGCGGGGCGCGCCGGGCGCCAGG + Intergenic
1123546910 15:21344804-21344826 CGCGGGGCGCGCCGGGCGCCAGG + Intergenic
1123709957 15:22980143-22980165 CGCCGGGGAGGCCGCGCCGCCGG + Intronic
1124966602 15:34437022-34437044 CGCCGGGCTGGTCGGGCCGCTGG - Intronic
1124983221 15:34583141-34583163 CGCTGGGCTGGCCGGGCCGCTGG - Intronic
1125606324 15:40941795-40941817 CGCGGGGGGCGGGGAGCCGCGGG - Intergenic
1126736630 15:51737574-51737596 CGCGGGGGCCGCCTTCCCGCAGG + Exonic
1130945290 15:88546436-88546458 GGCGGGGGCCGCGGGGCCTCTGG + Intronic
1132364958 15:101250981-101251003 CTCGGGAGACGCCGGGCCGAGGG - Intronic
1202955241 15_KI270727v1_random:72020-72042 CGCGGGGCGCGCCGGGCGCCAGG + Intergenic
1132480583 16:164724-164746 CGCGGGGCGGGCGGGGCCGCGGG + Intronic
1132585879 16:705592-705614 CGCGGGGGCCGCCGGGGTGCTGG + Exonic
1132851468 16:2026801-2026823 GGCGGGGGCGGCCGGGCGGCGGG + Intronic
1132987719 16:2776805-2776827 CGCGGGGATCTCCGGTCCGGGGG - Intronic
1133156485 16:3880219-3880241 CGGGGGGGCGGCCGGGCCGCCGG - Exonic
1133298417 16:4766989-4767011 TGCGGGGGGCGCGGGGACGCGGG - Intronic
1133801720 16:9090765-9090787 CTCGGGGGACGCCAGGGCGCAGG + Intergenic
1134084217 16:11345602-11345624 CACGGGCGGCGGCGGGCCGCGGG + Exonic
1134149832 16:11797057-11797079 CGCGGGGGGGGCGGGGGCGCGGG + Intronic
1139140900 16:64261187-64261209 GGCGGGGGGCGACGGACCGCGGG - Intergenic
1141054593 16:80803950-80803972 CGCGGGAGGCGGCGGGCGGCGGG + Intronic
1141430396 16:83968149-83968171 CGCGGGCGTGACGGGGCCGCGGG + Intergenic
1141430567 16:83968603-83968625 GGCGGGGGTCGGCGGGCTTCCGG + Intergenic
1142156308 16:88534229-88534251 CGGGGGCGTGGCCGGGCGGCGGG - Exonic
1142278579 16:89136163-89136185 CGCGGGGCTCCCGGAGCCGCTGG + Intronic
1142395353 16:89828580-89828602 CGCGGCGGGCGCAGGGCGGCCGG + Exonic
1142836999 17:2594284-2594306 GGCGGGGGTCGCAGAGGCGCCGG - Intronic
1143485370 17:7251313-7251335 CGCGGGGGCCCCGGGGCCGGCGG - Exonic
1144775479 17:17782737-17782759 CGCCCGGCTCGCCGGGCCCCAGG - Intronic
1145031315 17:19507359-19507381 CGCGGGGGACGCGGGGGCGCGGG - Intronic
1146053306 17:29568659-29568681 CGCGGGCGGCGCGGGGGCGCTGG + Exonic
1147184439 17:38705756-38705778 CGCGGGGGGCGGCGGGACCCCGG + Intronic
1148852350 17:50561258-50561280 CCCGCGGGGCGCCGGGGCGCAGG - Intronic
1150108382 17:62478500-62478522 CGCAGGGCGCCCCGGGCCGCCGG + Intronic
1151784760 17:76270138-76270160 CTCGGGGGTCCCCGAGCCACTGG - Intronic
1152239077 17:79152246-79152268 CCCGGGGGTGGCCAGGCCCCAGG - Intronic
1152376191 17:79920082-79920104 CTCGGGGCTCCCCGGGGCGCAGG - Intergenic
1152581027 17:81165716-81165738 CGCGGGGGACGCCAGCCCACAGG + Intronic
1152703864 17:81833095-81833117 CGGGGGAGTGGCCGGGCAGCCGG - Intronic
1152729032 17:81960960-81960982 GGCGGGGGATGCCGGGCCGGGGG + Exonic
1154218753 18:12434167-12434189 CGCTGCGGAAGCCGGGCCGCGGG + Intergenic
1154448023 18:14450486-14450508 CGCGGGGCGCGCCGGGCGCCAGG + Intergenic
1155002953 18:21704475-21704497 CGGGGGTGGCGCAGGGCCGCGGG - Intronic
1155053237 18:22165744-22165766 CGCCGGGGTCCCCGGGCGGTCGG - Intergenic
1155152690 18:23135490-23135512 CCCGCCGGTCGCCTGGCCGCTGG - Intronic
1156275703 18:35581441-35581463 CGCGGGGGAGGCGGGGGCGCCGG - Intronic
1156350473 18:36297785-36297807 CCCGGGGTTAGCGGGGCCGCGGG - Intronic
1157849066 18:51030524-51030546 CGAGGAGCTCTCCGGGCCGCCGG + Exonic
1158505538 18:58044024-58044046 GGCGGGGGTCACCCGGCCGCGGG - Intergenic
1158893501 18:61893964-61893986 GGAGGGGGTGGCGGGGCCGCAGG - Intronic
1160499754 18:79395851-79395873 CGCGGGAGCCGCCGGGCCGGCGG + Intronic
1160567884 18:79798279-79798301 CGAGGGGGGCGTCGGGCCGGAGG + Intergenic
1160690982 19:460664-460686 CGCGGGGGTCGCGGGGCGGGCGG - Exonic
1160858940 19:1229523-1229545 CGCCGGGGTCGCTGTGCTGCCGG + Exonic
1160919514 19:1513188-1513210 CGCAGGGGTCCCGGAGCCGCAGG + Exonic
1161072688 19:2270501-2270523 CGCGGGGGCCGCCGGGGAGCTGG + Intronic
1161210221 19:3062049-3062071 TGGGGGGGGCGCCGGGCCGGAGG + Intronic
1161266414 19:3366691-3366713 TGCGGGGGGCGCGGGGGCGCCGG - Intronic
1161853760 19:6752672-6752694 CTCTGGGGTAGCCGGGGCGCGGG - Exonic
1161854020 19:6753555-6753577 CGAGGAAGTCGCGGGGCCGCTGG - Exonic
1162128245 19:8510882-8510904 CGCGGGGGCCGCGGGGGCGCCGG + Exonic
1162435259 19:10654383-10654405 CGCGGTGCGCGCCGGGCTGCTGG - Exonic
1162572382 19:11480794-11480816 CGCGCGGATGGCCGGGCCCCGGG + Exonic
1162797568 19:13094798-13094820 CGCGGGGGTCCCCGGGCTGGAGG - Exonic
1165242790 19:34481503-34481525 CGCCCGGGCCGTCGGGCCGCTGG - Intergenic
1165734075 19:38164731-38164753 GGCGGGGGTCGCGAGGCCGCTGG + Exonic
1166039110 19:40191581-40191603 GGCGGGGGTGGCGGGGCCCCTGG - Intergenic
1166984019 19:46649170-46649192 CGGGAGCGTCCCCGGGCCGCCGG - Exonic
1168314136 19:55476738-55476760 CGCGGGGGTCGACGGGAAGGTGG - Exonic
924985014 2:263455-263477 CGCCGGGGTCGCGGGGCCACAGG - Intronic
927811846 2:26184835-26184857 CGCGCGGGTCCCCGGCCAGCAGG - Exonic
930762303 2:55050017-55050039 GGCAGGGGTCCCCGGGGCGCCGG + Exonic
931867249 2:66426204-66426226 CGAGTGGGCCGCCGTGCCGCAGG + Intergenic
934966672 2:98730546-98730568 CGCGGGGGCCGCGGGGCAGGTGG - Intronic
935622924 2:105144377-105144399 CTCGGGGCCCGCCGGGCCGCGGG + Intergenic
938482671 2:131674142-131674164 CGCTAGGGTTTCCGGGCCGCTGG + Intergenic
942083932 2:172427479-172427501 CGGGCGGTGCGCCGGGCCGCGGG + Intronic
943692295 2:190881202-190881224 GGCGGGGGACGGCCGGCCGCGGG + Exonic
945225843 2:207530383-207530405 GGCGGGGGGCGGCGGGCGGCGGG + Intronic
946340033 2:219060761-219060783 GGCGGGGGGCGGCGGGCGGCGGG + Intergenic
947723243 2:232381671-232381693 GGCGGGGGGCGCCAGGTCGCAGG - Exonic
947860560 2:233354680-233354702 CGCCCGGGCCGCCGCGCCGCGGG - Intronic
948560630 2:238848958-238848980 CGGGGGAGTCACCGGTCCGCCGG - Intronic
948893096 2:240916476-240916498 CGCAGGGGGCGCGGGGGCGCGGG - Intergenic
948926523 2:241102212-241102234 CGCGGGCTTCTCCGGGTCGCAGG - Intronic
948958558 2:241314985-241315007 CGCGGGCGGCTCCGGCCCGCGGG - Intronic
1168757342 20:326357-326379 CGCGGGGGCCGCCGAGCAGCGGG + Exonic
1168804423 20:664150-664172 CGCGGGGCGCGCGGGGGCGCAGG - Exonic
1169214797 20:3786667-3786689 CGGGCGCGTCGCCGGGCGGCGGG + Exonic
1170562638 20:17570180-17570202 CGCGGCGGTCGCAGGGACGCGGG - Exonic
1173506470 20:43591033-43591055 AGCGGTGGTCGCTGGGCCTCAGG + Exonic
1173822963 20:46030533-46030555 CGCAGGGGACGCAGCGCCGCTGG - Intronic
1173827707 20:46058023-46058045 CCCGCGGGCCTCCGGGCCGCCGG - Intronic
1174246885 20:49188247-49188269 GGCGGGCGCCGCCGGGCCGGGGG + Exonic
1175846974 20:62064701-62064723 CGCCGTGCTGGCCGGGCCGCTGG + Exonic
1175847077 20:62064946-62064968 CGGCGGGGTGGCCGGGCGGCCGG + Exonic
1175859718 20:62143687-62143709 CGCGGGGGGCGCCGCGTCGTGGG - Intergenic
1175887974 20:62303051-62303073 TGCGGGAGTCGCCGGGCCTGGGG + Intronic
1176148025 20:63574092-63574114 CGCGGGGGTCCCAGGGTGGCGGG - Intronic
1176148054 20:63574156-63574178 CGCGGGGGTCCCAGGGCGGAGGG - Intronic
1176157098 20:63627297-63627319 CGCGCGGGCGGCCGGGCCGAGGG + Intergenic
1176448210 21:6840223-6840245 CGCGGGGCGCGCCGGGCTCCAGG - Intergenic
1176550123 21:8217269-8217291 GGCGGCGGTCGGCGGGCGGCGGG + Intergenic
1176555530 21:8252711-8252733 CGCGGGGATCGCCGGAGGGCCGG + Intergenic
1176569051 21:8400304-8400326 GGCGGCGGTCGGCGGGCGGCGGG + Intergenic
1176576965 21:8444539-8444561 GGCGGCGGTCGGCGGGCGGCGGG + Intergenic
1176826380 21:13705245-13705267 CGCGGGGCGCGCCGGGCTCCAGG - Intergenic
1176867923 21:14064009-14064031 CGCGGTGGCCGCCGGGCTCCCGG - Intergenic
1179213655 21:39348837-39348859 CGCGGGGCCCGGCGGGGCGCCGG + Intronic
1179511825 21:41878821-41878843 GGCGGGGGCCGCGGGGCCGCGGG + Exonic
1179511937 21:41879149-41879171 CGCGGGGGGCGGGGGGCAGCGGG + Intronic
1179800265 21:43808452-43808474 CGCGGGGGTGGCAGAGCCGAAGG - Intergenic
1179893688 21:44350240-44350262 CGCGGGTGACGCCGGGGCGCGGG + Intronic
1180092878 21:45541986-45542008 CGCGGGGGTCGCGGTGGCCCGGG - Intronic
1180960576 22:19760672-19760694 CGCGGGGGTGGGGGGGCCCCGGG + Intronic
1181792255 22:25277662-25277684 CGGGGTGGTGGCCGGGCAGCGGG + Intergenic
1181811373 22:25405497-25405519 CGTGGGGCCCGCCCGGCCGCCGG - Intergenic
1183545895 22:38454836-38454858 CGCGCGCGGCGCCGGGCAGCCGG + Intronic
1183720182 22:39557894-39557916 CGCGGGGGGCGGCGGGCGGGGGG - Intergenic
1183966654 22:41446476-41446498 CCCGGGCGTCGCCGGGCCAGGGG + Exonic
1184593857 22:45502814-45502836 CGCGGCGGAGGCGGGGCCGCGGG - Intronic
1184712755 22:46262846-46262868 CGCGGGGGAGGCCGGGCGGGCGG + Exonic
1184724626 22:46336207-46336229 AGCTGGGATCGCCGGGCCGGGGG + Intronic
1184767111 22:46577590-46577612 GGTGGGGGTCGCCGGACCGGGGG + Intronic
1184795130 22:46727835-46727857 CGCGGGGGTGGCAGGGCCGGGGG - Intronic
1185296720 22:50058322-50058344 GGCGGGGGGCGCGGGGGCGCGGG + Intergenic
1185313747 22:50170252-50170274 CGCGGCGGGAGCGGGGCCGCCGG + Intergenic
1185397472 22:50600442-50600464 CGCCGGGGTCCGCGGGCCTCGGG - Intronic
1203255016 22_KI270733v1_random:133601-133623 GGCGGCGGTCGGCGGGCGGCGGG + Intergenic
1203263072 22_KI270733v1_random:178680-178702 GGCGGCGGTCGGCGGGCGGCGGG + Intergenic
949969996 3:9396746-9396768 CGCGGGGGTGGCGGGGAGGCGGG - Intergenic
951080412 3:18445104-18445126 CGCGGGGTCCGCCGAGCCCCCGG - Intronic
951543624 3:23806103-23806125 GCCGGGGGGCGGCGGGCCGCTGG - Intronic
951543657 3:23806176-23806198 CGCCGGGGCCGCCGGGCCGCAGG + Intronic
952451759 3:33440043-33440065 AGCGGGAGCGGCCGGGCCGCCGG + Exonic
953883102 3:46701553-46701575 CGCGGGGGTTGCCGGGCAGCTGG + Exonic
954390809 3:50267198-50267220 GGCTGGGGTGGCCGGGCAGCTGG - Intergenic
959849831 3:111072401-111072423 CGCGCGGGTCGCCGTGCGGATGG + Intronic
961377284 3:126475509-126475531 GGGGGGGGCGGCCGGGCCGCTGG + Exonic
963133066 3:141876353-141876375 GGCGGGCGTCCCCGCGCCGCAGG - Intronic
964771257 3:160226001-160226023 TCCGGGGGGCGCCGGACCGCTGG + Exonic
964786296 3:160399912-160399934 CGCGCGGGAGCCCGGGCCGCCGG - Intronic
966182018 3:177197028-177197050 GGCCGGGGGCGCTGGGCCGCGGG - Intronic
966696330 3:182793705-182793727 CGCGGGGGCCGCGGGGCTGCAGG - Exonic
966849448 3:184155605-184155627 CGCGCGGGCCGCCGGGCCCGAGG + Exonic
966860814 3:184230144-184230166 CGCGGGGGGCCCCGGGGGGCCGG + Intronic
967849474 3:194071132-194071154 CGCGGGGGCGGCCGGGCAGGCGG + Intergenic
968640427 4:1711975-1711997 CGCGGGGGACGGCGGGCTGCGGG + Exonic
968674651 4:1871157-1871179 CGCCGGGAGGGCCGGGCCGCGGG - Intergenic
968701408 4:2059709-2059731 GGCGGGGGGCGCGGGGCCGCCGG + Exonic
968729225 4:2261868-2261890 CGCGGCGGTGGGCGGGCGGCGGG - Intronic
968965119 4:3765837-3765859 CGCGGGGCGGGGCGGGCCGCGGG - Intergenic
969737479 4:9001098-9001120 CGCGGGGGTGCCGGGGACGCGGG + Intergenic
974385725 4:61200887-61200909 CTCGGGGTTCGCCGGCCCCCGGG + Intergenic
984973439 4:185209969-185209991 CGCCGGGGGCCCCGGGCGGCCGG + Intronic
985247872 4:187995495-187995517 CGCGGGGGTCAGGGGGCCCCGGG + Intergenic
985688630 5:1294990-1295012 CGCGGGGGTGGCCGGGGCCAGGG + Exonic
986315354 5:6583195-6583217 GGCGGGGAACGCGGGGCCGCGGG + Intergenic
990699394 5:58459661-58459683 AGCGGAGGGCGCCGGGCTGCCGG - Intronic
997177723 5:131796793-131796815 GGCGGGGGTCGCGGAGCCGATGG - Intronic
1001506469 5:172284000-172284022 CGCGGGGCTCGCCTGGACTCGGG - Exonic
1002029280 5:176416199-176416221 CGCGGGGGCCGCATGGCTGCCGG + Exonic
1002158930 5:177303683-177303705 CGCGGGAGTCGCGGCGCTGCGGG - Exonic
1002409194 5:179060670-179060692 AGCTGGGTGCGCCGGGCCGCTGG + Intronic
1002664075 5:180810149-180810171 CGAGGGGAGGGCCGGGCCGCTGG - Intronic
1003074480 6:2971388-2971410 CGCGTGGGTCGACGGCGCGCGGG - Intronic
1003212388 6:4079257-4079279 CTCGGGGGTCACCCGGCCGCCGG + Exonic
1004627884 6:17393800-17393822 TGCGGGGGGCGCCTGGCGGCGGG + Intronic
1006491500 6:34392221-34392243 GGCCGGGGTCGCCGGGTCTCCGG - Intronic
1008545235 6:52577453-52577475 CCCGGGGGTGGCCGGGCAGCCGG + Intergenic
1010032871 6:71288743-71288765 GGCGGCGGTCCCGGGGCCGCCGG + Intergenic
1011195457 6:84774827-84774849 CGCTGGACTCGCCGGGCTGCGGG + Intergenic
1011277098 6:85642488-85642510 CGTGGCGGTCGCCGCGGCGCGGG - Intronic
1011734171 6:90296044-90296066 CCCGGGCCTCGCCGGGCCGGGGG + Intronic
1013575735 6:111482700-111482722 AGCGGGAGTCGGCGGGGCGCCGG - Intronic
1015244772 6:131063336-131063358 CGCGGGGGTTTCCGCGCCGGGGG - Intergenic
1015314967 6:131807745-131807767 CGGGAGGGTGGCCGGGGCGCGGG + Intergenic
1015440407 6:133241192-133241214 CGCGGGGGGCGGCGGCGCGCGGG - Intronic
1017660702 6:156670455-156670477 CGGGGCGGTGGCCGGGCCGGGGG - Intergenic
1017880555 6:158560006-158560028 CGCGGTGGAAGCGGGGCCGCGGG - Intronic
1018091331 6:160348652-160348674 CTCGGGGGGCTCTGGGCCGCGGG - Exonic
1018942621 6:168319543-168319565 CGCGGCGTTCGCGGGGCTGCAGG - Exonic
1019395712 7:816707-816729 CGGGGCGGGCGCCGGGCTGCGGG + Intronic
1019427189 7:983290-983312 CCCGGGGGCCACCGGGCAGCTGG - Exonic
1019531307 7:1504707-1504729 AGCGGGGGCGGCCGGGGCGCAGG + Intergenic
1019562352 7:1665216-1665238 CGAGAGGGTCGTCGGGCCCCTGG - Intergenic
1019734832 7:2645475-2645497 TGTGGGGGTCGCCTGGCCTCGGG + Intronic
1020418263 7:7969635-7969657 CGCGGGCCGCGCCGGGCCCCGGG - Exonic
1022091953 7:27113771-27113793 CGCGGCGGTGACCGGGCCTCGGG - Intronic
1022109664 7:27220583-27220605 CACGGAGGAGGCCGGGCCGCGGG + Intergenic
1022715171 7:32891928-32891950 CGCGCGCGTTCCCGGGCCGCGGG - Intronic
1022814949 7:33905033-33905055 CGCTGGGGGCGCCCGGGCGCAGG - Exonic
1024965506 7:55019583-55019605 CGCGTGGGACACCGGGCTGCAGG + Intronic
1025069763 7:55887798-55887820 GGCGGGGGGCGGCGGGCGGCGGG + Intronic
1026776543 7:73234697-73234719 AGCGGGGGGCGCCGCCCCGCAGG + Intergenic
1026941548 7:74290245-74290267 CTCTGGGGTCGCCTGGCCGATGG + Intronic
1027017394 7:74788067-74788089 AGCGGGGGGCGCCGCCCCGCAGG + Exonic
1027070628 7:75157865-75157887 AGCGGGGGGCGCCGCCCCGCAGG - Intergenic
1029711218 7:102301045-102301067 CGCGGGGCTCGGCGGTGCGCGGG - Exonic
1030023755 7:105301426-105301448 AAAGGGGGTCGCCGGGCCTCTGG + Intronic
1032344451 7:131106212-131106234 AGCCGGGGGCGGCGGGCCGCCGG - Intergenic
1034228072 7:149497941-149497963 GGCCGGGGTCGCGGGGTCGCGGG - Intergenic
1034680683 7:152925462-152925484 GGCGGGGATCGCAGGGCCGAGGG + Intergenic
1034959917 7:155358739-155358761 CACAGGGGTCCCCGCGCCGCCGG - Exonic
1036787669 8:11698676-11698698 CGAGGGAGTCCCCGGGCCTCCGG - Intronic
1036910538 8:12754575-12754597 CCCCGGGGCCGCTGGGCCGCTGG - Intronic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1038466893 8:27772614-27772636 CGCGGCGGCCGCCTGGCCCCCGG + Exonic
1040355881 8:46617703-46617725 GGCGGGGCTCGCGGGGCGGCTGG + Intergenic
1041108821 8:54467004-54467026 TGCGGGCGCCCCCGGGCCGCGGG - Intergenic
1041281121 8:56211657-56211679 CGCGCGGGGCCCTGGGCCGCAGG - Intergenic
1041792672 8:61714447-61714469 CGCTGGCGGCGGCGGGCCGCTGG + Exonic
1045216965 8:100158282-100158304 CGCGGGGCTTTCCAGGCCGCGGG + Intronic
1049194521 8:141308116-141308138 CGCGGGGGCGGCGGGGCGGCCGG + Intronic
1049571541 8:143372309-143372331 GGCGGGGGTGGGCGGGCCTCAGG + Intronic
1049788524 8:144462611-144462633 GGCGGGGGCGGCCCGGCCGCGGG - Intronic
1050091298 9:2017667-2017689 AGCGGCGGGGGCCGGGCCGCGGG + Intronic
1057207875 9:93184340-93184362 CGCCCTGGCCGCCGGGCCGCGGG + Intergenic
1057592376 9:96383637-96383659 GGCGGGGTCCGCGGGGCCGCAGG - Exonic
1057785979 9:98087634-98087656 CGAGGTCGTCGCGGGGCCGCAGG + Exonic
1058439209 9:104991743-104991765 CGCGGCGGGCGGCGGGCAGCGGG + Intergenic
1058885743 9:109320372-109320394 CGCGGGGCGCGGCGGGGCGCGGG - Exonic
1059375338 9:113876443-113876465 CGCGGGGGACCCCGGGGGGCCGG + Intronic
1059633907 9:116154266-116154288 CGCGGGGGTCGGCCGGCCCGCGG - Exonic
1060555224 9:124504531-124504553 GGCGGGGGTCGGCGGGCTCCGGG + Intronic
1060945898 9:127569164-127569186 CGCGGCGGGCGCAGGGCAGCGGG - Intronic
1061128213 9:128689744-128689766 CGCGGGGGGCGCCGGGCGGGGGG + Intronic
1061317157 9:129803444-129803466 TGCGGGGGGCGCGGGGGCGCGGG + Intronic
1061666625 9:132163674-132163696 CGCGGCGGGCGCGGGGCCCCTGG - Intronic
1062230447 9:135479424-135479446 CGCAGGGGGCGCGGGGTCGCCGG - Intronic
1062230510 9:135479563-135479585 CGGGGGCGTCCCCGGGGCGCGGG + Intronic
1062277177 9:135736593-135736615 CGCGGCGGGCGGCGGGCGGCGGG - Intronic
1062349881 9:136133405-136133427 CGCGGGGGTCCGGGAGCCGCGGG - Intergenic
1062408692 9:136410511-136410533 CGCGGGGGCGGCCGAGCGGCGGG - Exonic
1062609812 9:137368851-137368873 GGCGGGGGTCTCAGGGCCGTGGG + Intronic
1203520981 Un_GL000213v1:44295-44317 CGCGGGGCGCGCCGGGCTCCAGG + Intergenic
1203471416 Un_GL000220v1:116741-116763 GGCGGCGGTCGGCGGGCGGCGGG + Intergenic
1203479237 Un_GL000220v1:160713-160735 GGCGGCGGTCGGCGGGCGGCGGG + Intergenic
1185747607 X:2584615-2584637 GGCGGGGGGCGCGGGGGCGCGGG + Intergenic
1186496291 X:10015046-10015068 CGCGGAGGACGCGGGGCCGGGGG + Intergenic
1188736782 X:33726750-33726772 TGCGGGGGGCGCGGGGCGGCTGG + Intergenic
1189333892 X:40158409-40158431 CGCGGGCGTTCCCGGGCTGCCGG + Intronic
1190300317 X:49053593-49053615 GGCGGAGGTGGCCGTGCCGCTGG + Intronic
1190881455 X:54495393-54495415 CCCGGGGGGCGCCGGGCCTTCGG - Exonic
1191251440 X:58261955-58261977 CGCAGGGGTCGCGGGGACACTGG + Intergenic
1196465613 X:115969042-115969064 CGCGGGAGTCGCGTTGCCGCAGG - Intergenic
1196819666 X:119692866-119692888 CGCGGGGGGCGGGGGGCGGCAGG - Intronic
1198321452 X:135521743-135521765 CGCGAGGGTCGCCGCGCGGGGGG + Intronic
1200000184 X:153056243-153056265 CACGGGGGCCCCCGGGCCCCCGG - Intergenic
1200117570 X:153776055-153776077 CCCGGGGCTGGCGGGGCCGCAGG + Exonic