ID: 1089262533

View in Genome Browser
Species Human (GRCh38)
Location 11:117232624-117232646
Sequence ACTTCCGGCGGCACGAGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 21}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089262533_1089262540 -5 Left 1089262533 11:117232624-117232646 CCTCCGCTCGTGCCGCCGGAAGT 0: 1
1: 0
2: 0
3: 4
4: 21
Right 1089262540 11:117232642-117232664 GAAGTGGGAGGTGCCGCGCGCGG 0: 1
1: 0
2: 1
3: 22
4: 157
1089262533_1089262546 27 Left 1089262533 11:117232624-117232646 CCTCCGCTCGTGCCGCCGGAAGT 0: 1
1: 0
2: 0
3: 4
4: 21
Right 1089262546 11:117232674-117232696 CGACCCCTCCCCCCGTGGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 132
1089262533_1089262541 -4 Left 1089262533 11:117232624-117232646 CCTCCGCTCGTGCCGCCGGAAGT 0: 1
1: 0
2: 0
3: 4
4: 21
Right 1089262541 11:117232643-117232665 AAGTGGGAGGTGCCGCGCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 84
1089262533_1089262545 22 Left 1089262533 11:117232624-117232646 CCTCCGCTCGTGCCGCCGGAAGT 0: 1
1: 0
2: 0
3: 4
4: 21
Right 1089262545 11:117232669-117232691 GCGCTCGACCCCTCCCCCCGTGG 0: 1
1: 0
2: 1
3: 11
4: 93
1089262533_1089262542 0 Left 1089262533 11:117232624-117232646 CCTCCGCTCGTGCCGCCGGAAGT 0: 1
1: 0
2: 0
3: 4
4: 21
Right 1089262542 11:117232647-117232669 GGGAGGTGCCGCGCGCGGGCCGG 0: 1
1: 0
2: 10
3: 34
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089262533 Original CRISPR ACTTCCGGCGGCACGAGCGG AGG (reversed) Exonic