ID: 1089262540

View in Genome Browser
Species Human (GRCh38)
Location 11:117232642-117232664
Sequence GAAGTGGGAGGTGCCGCGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 157}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089262532_1089262540 -4 Left 1089262532 11:117232623-117232645 CCCTCCGCTCGTGCCGCCGGAAG 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1089262540 11:117232642-117232664 GAAGTGGGAGGTGCCGCGCGCGG 0: 1
1: 0
2: 1
3: 22
4: 157
1089262523_1089262540 30 Left 1089262523 11:117232589-117232611 CCGCGGCCTCTCCTCTCGCGGCC 0: 1
1: 0
2: 0
3: 23
4: 263
Right 1089262540 11:117232642-117232664 GAAGTGGGAGGTGCCGCGCGCGG 0: 1
1: 0
2: 1
3: 22
4: 157
1089262535_1089262540 -8 Left 1089262535 11:117232627-117232649 CCGCTCGTGCCGCCGGAAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1089262540 11:117232642-117232664 GAAGTGGGAGGTGCCGCGCGCGG 0: 1
1: 0
2: 1
3: 22
4: 157
1089262531_1089262540 -3 Left 1089262531 11:117232622-117232644 CCCCTCCGCTCGTGCCGCCGGAA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1089262540 11:117232642-117232664 GAAGTGGGAGGTGCCGCGCGCGG 0: 1
1: 0
2: 1
3: 22
4: 157
1089262525_1089262540 24 Left 1089262525 11:117232595-117232617 CCTCTCCTCTCGCGGCCGGAGCC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1089262540 11:117232642-117232664 GAAGTGGGAGGTGCCGCGCGCGG 0: 1
1: 0
2: 1
3: 22
4: 157
1089262530_1089262540 -2 Left 1089262530 11:117232621-117232643 CCCCCTCCGCTCGTGCCGCCGGA 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1089262540 11:117232642-117232664 GAAGTGGGAGGTGCCGCGCGCGG 0: 1
1: 0
2: 1
3: 22
4: 157
1089262528_1089262540 3 Left 1089262528 11:117232616-117232638 CCTCGCCCCCTCCGCTCGTGCCG 0: 1
1: 0
2: 2
3: 21
4: 290
Right 1089262540 11:117232642-117232664 GAAGTGGGAGGTGCCGCGCGCGG 0: 1
1: 0
2: 1
3: 22
4: 157
1089262527_1089262540 9 Left 1089262527 11:117232610-117232632 CCGGAGCCTCGCCCCCTCCGCTC 0: 1
1: 0
2: 3
3: 40
4: 421
Right 1089262540 11:117232642-117232664 GAAGTGGGAGGTGCCGCGCGCGG 0: 1
1: 0
2: 1
3: 22
4: 157
1089262526_1089262540 19 Left 1089262526 11:117232600-117232622 CCTCTCGCGGCCGGAGCCTCGCC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1089262540 11:117232642-117232664 GAAGTGGGAGGTGCCGCGCGCGG 0: 1
1: 0
2: 1
3: 22
4: 157
1089262533_1089262540 -5 Left 1089262533 11:117232624-117232646 CCTCCGCTCGTGCCGCCGGAAGT 0: 1
1: 0
2: 0
3: 4
4: 21
Right 1089262540 11:117232642-117232664 GAAGTGGGAGGTGCCGCGCGCGG 0: 1
1: 0
2: 1
3: 22
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089262540 Original CRISPR GAAGTGGGAGGTGCCGCGCG CGG Exonic