ID: 1089264432

View in Genome Browser
Species Human (GRCh38)
Location 11:117248691-117248713
Sequence GAAATTATGAGGAGTGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089264432 Original CRISPR GAAATTATGAGGAGTGTACC TGG Intronic
902978652 1:20107706-20107728 GAAAGTAGGGGGAGTGTTCCTGG + Intergenic
910669419 1:89758061-89758083 GCAATTAGCAGGAGTGTAACTGG + Intronic
913986370 1:143569652-143569674 GAAACTTAGAGGAGTGTCCCTGG + Intergenic
914938959 1:152005299-152005321 CAATTTATGATGAGTTTACCTGG - Intergenic
918600183 1:186349030-186349052 CAAATTATGATGAGTTTATCGGG - Intronic
920860603 1:209702764-209702786 GAAATTATTAAGAGTATACAAGG + Intronic
921911411 1:220553278-220553300 GGAACTTTGAGCAGTGTACCTGG - Intronic
1064332078 10:14403353-14403375 GAAATGATTAGGACTCTACCTGG - Intronic
1065166656 10:22986056-22986078 TAAATGATGATAAGTGTACCAGG - Intronic
1066617330 10:37308476-37308498 GAAAAAGTGAGGAATGTACCTGG - Intronic
1068844631 10:61658370-61658392 GAAACTACGAGGAGTATACATGG - Intergenic
1071187426 10:83060517-83060539 GAAATAATGAGGGCTGTCCCTGG - Intergenic
1074006764 10:109433789-109433811 GAAATCATGATGAGTCTGCCAGG + Intergenic
1074239747 10:111626007-111626029 GAAATGATGAGGAGTGTTGAGGG - Intergenic
1081761861 11:45582221-45582243 GAGATAATTAGGAGTGAACCAGG + Intergenic
1083557534 11:63643345-63643367 GAAATTAAAAGGTGTGTTCCAGG - Exonic
1084010590 11:66346413-66346435 GGAGTTATGAGGAGTGGCCCTGG - Intronic
1086878344 11:92124981-92125003 GAAATTAAGGGAAGTGTACAGGG - Intergenic
1087462806 11:98466772-98466794 CAGATTAGGAGGAGTGTCCCTGG + Intergenic
1089264432 11:117248691-117248713 GAAATTATGAGGAGTGTACCTGG + Intronic
1092151698 12:6253331-6253353 GAAATGATGGGGAGTGACCCAGG + Intergenic
1092176766 12:6413956-6413978 GAAATTAAAAGGAGAGGACCGGG - Intergenic
1094408967 12:30149352-30149374 GAAATTATGGGGAGTGAAAATGG + Intergenic
1094620109 12:32072750-32072772 GAAATGATGTGGAGTTCACCTGG + Intergenic
1095164492 12:38955788-38955810 GAAATTATAAGAAGTGCCCCAGG + Intergenic
1095692038 12:45100702-45100724 GAAGTGATGAGAAGTGTACTTGG - Intergenic
1098592108 12:72226338-72226360 GAAATTCTCAGGAGTGAACGAGG - Intronic
1100955761 12:99906130-99906152 GAAATTCTTAGGAGTAGACCAGG + Intronic
1107538416 13:41360068-41360090 GAAATTAAGAAGAGAGTACAAGG + Intronic
1108338447 13:49471499-49471521 GAATTTATTAGAAGTGTACGAGG + Intronic
1109251931 13:60030616-60030638 GAATTTCTGAGGAGGGGACCCGG - Intronic
1111102344 13:83604946-83604968 AAAATTATAAGGAATGTACATGG + Intergenic
1124324397 15:28745251-28745273 GAAAAAGTGAGGAGTGTTCCGGG + Intergenic
1124528276 15:30478293-30478315 GAAAAAGTGAGGAGTGTTCCGGG + Intergenic
1124770381 15:32529410-32529432 GAAAAAGTGAGGAGTGTTCCGGG - Intergenic
1137999273 16:53257470-53257492 GAAATAATGATGGGTGAACCAGG + Intronic
1143007244 17:3845310-3845332 GAAATTAAGAGGAGTCATCCAGG + Intronic
1147396386 17:40146331-40146353 GAACTTATGATGGGTTTACCAGG - Intronic
1150013175 17:61525352-61525374 GAATTTACTAGGAGTCTACCAGG + Intergenic
1152072990 17:78143378-78143400 GAGATGATGGGGAGTGGACCTGG + Intergenic
1153320122 18:3764728-3764750 GGAACCATGAGGAATGTACCAGG - Intronic
1153938313 18:9952149-9952171 GAAAATAGGAAGAGTGAACCAGG + Intronic
1159733192 18:72058319-72058341 AAAATTATGTGGAATGTACAGGG + Intergenic
1161855908 19:6765297-6765319 GGAATTCTGGGGAGTGTGCCAGG + Intronic
1165553156 19:36605473-36605495 GAAATTCTGAGGAGGAAACCGGG + Intronic
929253323 2:39782198-39782220 GTAATTCTGAGGAGTATTCCTGG - Intergenic
929844379 2:45507217-45507239 GAAATTATGAGATGTGTGTCTGG - Intronic
935426910 2:102929088-102929110 GAACTTAAGAGGATTATACCAGG + Intergenic
935464516 2:103380779-103380801 AAAATTTTGAGCAGTGTATCTGG + Intergenic
944225889 2:197348384-197348406 GAAATTATTAGAGGTTTACCTGG + Intergenic
944256415 2:197627311-197627333 GATATTATGGCGAGAGTACCAGG - Intronic
1169795233 20:9455519-9455541 GTAATTATTAGAAGTGTCCCTGG + Intronic
1174186956 20:48712815-48712837 GAGATCTTGAGGAGTGTGCCGGG - Intronic
1174729585 20:52902762-52902784 GAAATGATGAGAAGTGTGCTGGG - Intergenic
1177448953 21:21239727-21239749 CTAATTATGAAGACTGTACCTGG + Intronic
1180899211 22:19358716-19358738 GTAATTATGATGACTGTATCTGG + Intronic
954097990 3:48346457-48346479 AAAATTATGATGGATGTACCTGG - Intergenic
956086398 3:65615570-65615592 GCATTTATGAGGAGGGTTCCAGG + Intronic
958610448 3:96417290-96417312 GATATTGTCAGGAGTGCACCTGG + Intergenic
961316561 3:126040026-126040048 GAAAATATAAGGTGTGTACCTGG + Intronic
964930307 3:162012292-162012314 AAAATTATCAGGAGTTTAGCTGG + Intergenic
972697019 4:41457370-41457392 GAAATTATGTGGATTTTAACTGG + Intronic
975903888 4:79186804-79186826 GAAATTATCTGGAATGTACATGG + Intergenic
975948850 4:79743394-79743416 GAAATAATGAGGAAATTACCAGG - Intergenic
977067303 4:92334043-92334065 GAATTTAAGAGCAGTGAACCAGG - Intronic
980582240 4:134770341-134770363 GGATTTCTGAGCAGTGTACCTGG - Intergenic
988061018 5:26170893-26170915 GAAAATATCTGTAGTGTACCTGG - Intergenic
988400116 5:30751460-30751482 AAAATCATAAGCAGTGTACCTGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
992612769 5:78521759-78521781 GAAATTAGGAGGAGTGAAAGTGG - Intronic
994664895 5:102694653-102694675 GAAATTATGAGAAGTCACCCAGG + Intergenic
996191900 5:120554812-120554834 GAAATTATGAGAGGTGTTTCTGG - Intronic
996932377 5:128905239-128905261 GTAATTATGAGCAGTGTACTTGG - Intronic
1000451203 5:161389876-161389898 GAAATTATGAGCTGTGCAACTGG + Intronic
1001336867 5:170805728-170805750 GAAATGATGTGGAGTTCACCTGG + Exonic
1001849698 5:174952611-174952633 GAAACTCTGAGGAGTGTGCATGG + Intergenic
1004282233 6:14290246-14290268 TAAAATATGAGGAGTGTTCAGGG + Intergenic
1004791857 6:19035308-19035330 GAAATAAAGAGGAGTGGCCCTGG + Intergenic
1006636770 6:35466881-35466903 GAATTGATGAGGAGTGTGCCTGG - Exonic
1008280040 6:49586017-49586039 GAAATTAAGAGTTGTATACCAGG - Intergenic
1011432101 6:87298461-87298483 GAAATTCTGGGGTATGTACCAGG - Intronic
1014631706 6:123797274-123797296 AGAATTTTGAGCAGTGTACCTGG + Intergenic
1016284390 6:142456428-142456450 GAAAATATGGGGAGTGGAACAGG + Intergenic
1016602053 6:145873553-145873575 TAAATTCTGAGGAGGGTTCCTGG + Intronic
1018892533 6:167992454-167992476 GAAATTATTAGTAGTTTAACAGG - Intergenic
1019777368 7:2919867-2919889 GGAAATATGAAGAGTGTAGCGGG - Intronic
1022460330 7:30599049-30599071 GAAAGGATGAGGAGTCTACCAGG - Intronic
1023961699 7:44932652-44932674 GAAATAATTAGAAGTCTACCTGG + Intergenic
1030192077 7:106820236-106820258 TAAATTTTCAGTAGTGTACCAGG - Intergenic
1037729947 8:21515969-21515991 GAAGTTTTGAGCAGTGCACCTGG - Intergenic
1038365692 8:26931189-26931211 GAATTTATGAGTAGAGTACTGGG - Intergenic
1039023653 8:33234379-33234401 GAAAATATGAAGAGTATACTTGG - Intergenic
1041733857 8:61089616-61089638 GAAGTTATGAAGAATCTACCAGG + Intronic
1044690613 8:94873733-94873755 GAATTTATTAGGAGTGTATTAGG - Intronic
1045000663 8:97875303-97875325 GAAATTTTGAAGAGTTTAACAGG - Intronic
1045843725 8:106608534-106608556 AAAAATATGAGAAATGTACCTGG - Intronic
1045985033 8:108239939-108239961 AAAATTAAGACGAGTTTACCTGG + Exonic
1048966718 8:139620244-139620266 GAAATTTTGAAGGATGTACCTGG + Intronic
1051926394 9:22332209-22332231 TAAATTTTCAGGAGTGTTCCAGG - Intergenic
1052463541 9:28799226-28799248 GAAATTAGGAGGAATGACCCAGG + Intergenic
1058522001 9:105820869-105820891 GAAATTAGGAACAGTGTCCCTGG + Intergenic
1058581167 9:106459430-106459452 GAATGAATGAGGAGGGTACCAGG + Intergenic
1186061174 X:5709253-5709275 GAAATTAAGAGTAGTGATCCTGG + Intergenic
1194746499 X:97634262-97634284 GAAATAATCAAGAGGGTACCTGG + Intergenic
1196257986 X:113545300-113545322 GAAAGTAGGTGGAGTGTATCAGG + Intergenic
1196745475 X:119068064-119068086 GAAATTATGAGAACAGTGCCAGG + Intergenic
1200050225 X:153425341-153425363 GAAAGTATGAGGTGTGTTCAGGG + Intergenic
1201617522 Y:15918043-15918065 TAAATTCTGGGAAGTGTACCAGG + Intergenic