ID: 1089266617

View in Genome Browser
Species Human (GRCh38)
Location 11:117267821-117267843
Sequence TAGGTTCTACAGAAGTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089266617_1089266619 -6 Left 1089266617 11:117267821-117267843 CCTTGGCACTTCTGTAGAACCTA 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1089266619 11:117267838-117267860 AACCTAAAATGACCACTGTTGGG 0: 1
1: 0
2: 0
3: 17
4: 158
1089266617_1089266618 -7 Left 1089266617 11:117267821-117267843 CCTTGGCACTTCTGTAGAACCTA 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1089266618 11:117267837-117267859 GAACCTAAAATGACCACTGTTGG 0: 1
1: 0
2: 0
3: 7
4: 113
1089266617_1089266620 -5 Left 1089266617 11:117267821-117267843 CCTTGGCACTTCTGTAGAACCTA 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1089266620 11:117267839-117267861 ACCTAAAATGACCACTGTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089266617 Original CRISPR TAGGTTCTACAGAAGTGCCA AGG (reversed) Intronic
902409288 1:16203431-16203453 TAGATGCTCCAGAAGTGGCAGGG - Intronic
905010955 1:34746815-34746837 TTAGTTCTATAGATGTGCCACGG - Intronic
905265864 1:36754015-36754037 GAGGTGCCACAGAAGTGCCTTGG + Intergenic
905596535 1:39212446-39212468 TAGGTTCTGCTTGAGTGCCAGGG + Intronic
906692979 1:47804977-47804999 TGGGTTCCACAGAAGGGCCTTGG - Intronic
908850279 1:68368930-68368952 AAGGTATTACAGAAGAGCCAGGG + Intergenic
912404484 1:109425847-109425869 TAGTTTCTTCAGAAGCGCGAAGG - Intronic
913430398 1:118784938-118784960 TAGGTTCTACAGCAGTTCAGGGG + Intergenic
914473326 1:148002727-148002749 TAGGTTGGAGAGAAGTGACAAGG - Intergenic
917702374 1:177594384-177594406 TTGCTTCTACAGAACTGCCCTGG - Intergenic
921259319 1:213371728-213371750 TATGTTATGCAGAAGTGGCAGGG - Intergenic
921329317 1:214019718-214019740 TGGGCTCTGCAGATGTGCCAGGG - Intronic
922465992 1:225845863-225845885 CAGGGCCTACAGAGGTGCCAAGG + Exonic
922579444 1:226686106-226686128 TGGGTTCTGCTGAAGTGCCCTGG - Intronic
923058400 1:230447576-230447598 TGTGTTCTTCACAAGTGCCAAGG - Intergenic
923222162 1:231905291-231905313 TATGGTCTTCAGAAGTGCCAAGG + Intronic
1067268723 10:44770959-44770981 TAGTTTCTACAAATGTTCCATGG + Intergenic
1070666541 10:78349099-78349121 TAGGCTCCACAGAGGAGCCACGG + Intergenic
1073001917 10:100292134-100292156 TAAGTTCAACAGAAGTGACTAGG - Intronic
1075846633 10:125550311-125550333 TGGTTTCCAAAGAAGTGCCAAGG + Intergenic
1079338309 11:19590446-19590468 AAGGTTCTGCAGAGGTGCCTGGG - Intronic
1089237230 11:117040533-117040555 TAAATGCTACAGATGTGCCAAGG + Intronic
1089266617 11:117267821-117267843 TAGGTTCTACAGAAGTGCCAAGG - Intronic
1090145161 11:124313528-124313550 CAGGTTATAAAGAAGTGACAAGG + Intergenic
1090329031 11:125915456-125915478 TGTGTTCTACAGAACAGCCATGG + Intronic
1099092684 12:78333376-78333398 TAGGTTCTAGAGATTTGACATGG - Intergenic
1100327877 12:93557060-93557082 TATTTTCAACAAAAGTGCCAAGG - Intergenic
1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG + Intergenic
1105739432 13:23307579-23307601 TAGGTTCTACAGAACTGTATGGG + Intronic
1107945543 13:45414882-45414904 CTGGATCTACAGAAGTCCCAAGG + Intronic
1108086410 13:46797523-46797545 TAGTTTCTACATAAGTGACACGG - Intergenic
1111146690 13:84191230-84191252 GAGGATGTACAGAAGTGACAAGG + Intergenic
1113388198 13:109870468-109870490 TAGGTGCCACCCAAGTGCCACGG + Intergenic
1119438678 14:74613594-74613616 TAGGCTGTACAAATGTGCCAGGG - Intergenic
1120037875 14:79718404-79718426 TAGGTTTTATAAAAGTGCAATGG + Intronic
1122240515 14:100363061-100363083 TAGGTACTACAGAAATGAGATGG - Intronic
1124515832 15:30366894-30366916 TAGATTAGACAGCAGTGCCACGG + Intronic
1124727088 15:32163837-32163859 TAGATTAGACAGCAGTGCCACGG - Intronic
1126042178 15:44602247-44602269 TATGTTGAACAGAAGTGGCAAGG + Intronic
1126088459 15:45030767-45030789 TAGGTGCTGGAGAAGTGCAAAGG + Intronic
1128042459 15:64587350-64587372 TAGGTACTACAGATATGACACGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1135423667 16:22321805-22321827 TAGGGCTTACAGAAGTGCCGGGG - Intronic
1137916214 16:52433130-52433152 GAGGTACTACAAAAGTGCCAAGG - Intergenic
1141636542 16:85316941-85316963 TGGGTTCCCCAAAAGTGCCAGGG - Intergenic
1143107257 17:4535986-4536008 TGGGGGCTTCAGAAGTGCCACGG + Intronic
1144062834 17:11598875-11598897 TAGGTGCTCCAGAGGTGCCGCGG - Exonic
1144637147 17:16917382-16917404 TAGTTTTGACAGATGTGCCAGGG + Intergenic
1145038454 17:19558242-19558264 TATGTTCTTCAAAAATGCCAAGG - Intronic
1145325685 17:21822243-21822265 TAAGATTTACAGAAGTGCAATGG - Intergenic
1146533745 17:33632210-33632232 TAGGTTCTACATACTAGCCAAGG - Intronic
1153134062 18:1893092-1893114 TAGTTTCAACAAATGTGCCATGG + Intergenic
1157686433 18:49646237-49646259 TATGTTCTTCAAAAGTCCCATGG - Intergenic
1158889175 18:61857406-61857428 AAGGTTCTAAAGCAGTTCCAAGG - Intronic
1159527106 18:69606510-69606532 TATGTTCAATAGAAGTGGCAAGG - Intronic
1162254258 19:9475510-9475532 TAGGTTAGACAGAAGTGCAGTGG - Intronic
1162366941 19:10255455-10255477 TAGCTTCTACAGTAGACCCAAGG - Intronic
1164803964 19:31102032-31102054 TAGCTTCTACATATGTGGCAGGG - Intergenic
927893854 2:26769039-26769061 TGGGACCTACAGAAGGGCCAAGG - Intronic
932400759 2:71479571-71479593 TAGGTTCTACAGCAGTGGGCAGG - Intronic
933612444 2:84451174-84451196 TAGCTTCTACACAAATACCATGG - Intronic
934524993 2:95046277-95046299 AAGGTACTACAGAAGTGTCTGGG - Intronic
934630749 2:95918507-95918529 TATGTTCAACTGAAGTGTCATGG - Intronic
934630890 2:95920385-95920407 TACATTCAACTGAAGTGCCATGG - Intronic
941985990 2:171512232-171512254 TAGGCTGTACAGCAGTGACAGGG + Intergenic
944154605 2:196596194-196596216 TCCTTTCTACAGATGTGCCAAGG + Intergenic
947750844 2:232531233-232531255 ATGGTACTACAGAGGTGCCAGGG + Intronic
948202092 2:236136563-236136585 GAGATTCCACCGAAGTGCCATGG - Intergenic
1169810801 20:9607320-9607342 TGTGCTCTTCAGAAGTGCCAAGG + Intronic
1170777241 20:19387160-19387182 TAGATTCTACAGAAATACTAAGG - Intronic
1174674022 20:52336278-52336300 GAGGATCTACAAAAGGGCCAGGG + Intergenic
1174826300 20:53771632-53771654 TAGCTTTAACAGAAGTGCTATGG - Intergenic
1175003679 20:55658720-55658742 TAGATTCTACAGAATGGTCAAGG + Intergenic
1178091061 21:29163548-29163570 GAAGTTCTACAGAGGTTCCAAGG - Intronic
1178578849 21:33819343-33819365 TATGTTCTTCAGAAGGGTCAAGG + Intronic
1179838606 21:44055191-44055213 TAAGTTCTACAGAAATTCAAAGG - Intronic
950232224 3:11285989-11286011 TATAGTCTTCAGAAGTGCCATGG - Intronic
951335833 3:21420615-21420637 TAGGTTTTAAAGAATTGCAAAGG - Exonic
951655943 3:25008612-25008634 AAGGTACTAGAGAAGTACCAAGG - Intergenic
953568577 3:44053763-44053785 GAGCTTCTCCAGGAGTGCCAGGG + Intergenic
955672413 3:61415737-61415759 TTTGTTCTACAGATCTGCCAAGG + Intergenic
955930721 3:64054195-64054217 TAGGTTGGAGAGAGGTGCCAGGG + Intergenic
955931109 3:64057839-64057861 TAGGTTGGAGAGAGGTGCCAGGG - Intergenic
956956093 3:74342558-74342580 TAGGTTATAGAGTAGAGCCAAGG - Intronic
956956424 3:74346681-74346703 TATTTTCCACAGAAGTGCAATGG + Intronic
958951511 3:100422069-100422091 TAGATTCAACAGAAGTGCTGAGG + Intronic
960221578 3:115117353-115117375 TAGGTTACACAGAAGTGTTAAGG - Intronic
960377022 3:116915701-116915723 TAGGTCCCACAGAATTCCCAGGG + Intronic
961029278 3:123587728-123587750 TAGGTTCTACAGTAGTGAACTGG + Intergenic
961587415 3:127944705-127944727 TATGTTGTATAGAAGTGGCAAGG + Intronic
966938814 3:184732177-184732199 CAGGTTCTTCAGAATTGCTAGGG - Intergenic
967867603 3:194203480-194203502 AAGGTTCCAGAGAGGTGCCAAGG + Intergenic
974302631 4:60087774-60087796 TAGTTTCTAAAGAAGTTTCAGGG + Intergenic
974898187 4:67964808-67964830 TAGGCTCTCTAGGAGTGCCAAGG + Intergenic
975089649 4:70386960-70386982 CCAGTTCTACAGAAGTGCCTTGG + Intronic
982933317 4:161437114-161437136 TAGGTTCAACAGAGGAGGCAAGG + Intronic
983649154 4:170021188-170021210 CAGGCTCTACAGAAGTGCAGAGG - Intronic
986427879 5:7652766-7652788 TAGGTTCTTCATGAGTGCCTGGG + Intronic
987292643 5:16523159-16523181 TAGTTTCTACAAATGCGCCATGG - Intronic
992495746 5:77291395-77291417 TCGGTTCTACATAATTTCCAGGG - Intronic
995258673 5:110076330-110076352 GAGGTTCAACTAAAGTGCCATGG + Intergenic
996711931 5:126552104-126552126 TCGGTTCTACATAATTTCCAGGG + Exonic
996833539 5:127766501-127766523 TAGAATCCACAGAAGTCCCATGG - Intergenic
998866340 5:146507029-146507051 TACGTTCTTCAGATGTGTCATGG + Exonic
1000639633 5:163686251-163686273 TAGGTTCTACTGAAGAGAAAGGG + Intergenic
1001023458 5:168203865-168203887 AAGGTTCCAGAGAAGTGGCAAGG - Intronic
1002318773 5:178362666-178362688 TAGTTCCAACAGAAGTCCCATGG - Intronic
1003036864 6:2647935-2647957 TAGATTCTACAGATGTGAAAAGG + Intergenic
1003386807 6:5675688-5675710 GAAGTTCCACAGAAGTGCCTGGG + Intronic
1005852382 6:29831258-29831280 AAGGTTCTACTGAAGGGCCAAGG - Intergenic
1005859764 6:29891211-29891233 AAGGTTCTACTGAAGGGCCAAGG - Intergenic
1005867338 6:29946010-29946032 AAGGTTCTACTGAAGGGCCAAGG - Intergenic
1005876016 6:30010096-30010118 AAGGTTCTACTGAAGGGCCAAGG - Intergenic
1008648558 6:53541317-53541339 AAGGTTTCACTGAAGTGCCATGG + Intronic
1009876372 6:69510801-69510823 AATGCTCTACAGAAATGCCAAGG - Intergenic
1010268756 6:73896863-73896885 CAGGTTCTGCAGCAGTGCCTTGG - Intergenic
1010774595 6:79870469-79870491 TAGTGTCTACAGCAGTGGCATGG + Intergenic
1012215622 6:96579803-96579825 TGGGCTCTACAGAAGTGTCTGGG + Intronic
1013206440 6:107950467-107950489 TACATTGTTCAGAAGTGCCATGG + Intronic
1017136963 6:151155940-151155962 TAAGTTCTACAAAACTTCCATGG - Intergenic
1017381859 6:153840426-153840448 TTACTTCTACAGAAGTGCAAAGG + Intergenic
1019175102 6:170155475-170155497 TGGGTTCTACAGAGGGGCCCTGG - Intergenic
1023333582 7:39145447-39145469 TAGGCTCAACAAATGTGCCAAGG - Intronic
1024801099 7:53079869-53079891 GAGGTTCAACAAATGTGCCAAGG + Intergenic
1030947102 7:115737316-115737338 AAATTTTTACAGAAGTGCCAAGG + Intergenic
1032009143 7:128330673-128330695 TGGGTTCTATAAAAGTACCAGGG - Intronic
1032481452 7:132250448-132250470 TAGGTTTTAGAGTAGAGCCAAGG - Intronic
1035134095 7:156683966-156683988 TAGGTTCTGAAGAGGGGCCACGG + Exonic
1035170749 7:157016182-157016204 TGGGTTCTAAAGGAGTGCCTGGG - Intergenic
1040792027 8:51242651-51242673 TTGGTTCTACATCAGTGCCTAGG - Intergenic
1043414673 8:80034393-80034415 CAGGCTCTGCAGAAGTGGCAGGG - Intronic
1045830256 8:106451015-106451037 TAGGTTCTATAGGAGTGCAAAGG - Intronic
1050527920 9:6562348-6562370 CATGTGCTACAGAAGTGCCTGGG - Intronic
1054922726 9:70558103-70558125 TAGTTTCAACAAAAGTTCCAAGG - Intronic
1058807020 9:108602636-108602658 GAGCTTCCACAGAAGTGACATGG + Intergenic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1059927275 9:119222598-119222620 TAGGTTCTAGAGAAAAGACAAGG + Intronic
1062645977 9:137548373-137548395 AAGTTTCTACACAAGAGCCAAGG + Intronic
1186683227 X:11897836-11897858 TATGTTAGACATAAGTGCCATGG + Intergenic
1189573522 X:42325079-42325101 TAGGTTCTTAAGAGGTCCCAAGG - Intergenic
1198056746 X:133003251-133003273 TAAGTGCAACTGAAGTGCCAGGG - Intergenic
1201448076 Y:14080201-14080223 TGGGATCTACAGAGGTGACACGG - Intergenic