ID: 1089266756

View in Genome Browser
Species Human (GRCh38)
Location 11:117269297-117269319
Sequence AAGGTTCTTTTGAACTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 415}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089266750_1089266756 0 Left 1089266750 11:117269274-117269296 CCTAAACAACAATGGCCTGGGAC 0: 1
1: 5
2: 10
3: 25
4: 151
Right 1089266756 11:117269297-117269319 AAGGTTCTTTTGAACTTTGGGGG 0: 1
1: 0
2: 2
3: 25
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089266756 Original CRISPR AAGGTTCTTTTGAACTTTGG GGG Intronic
901838856 1:11941305-11941327 AAGGTACTTTTGTACTTTTGTGG - Intronic
902133563 1:14284536-14284558 AAGATTCTGTTGGACTTTGCAGG + Intergenic
902423441 1:16300051-16300073 AAGGTTCATTTGAACTTGTTGGG - Intronic
906435797 1:45795547-45795569 AAGGATCACTTGAACTTGGGAGG - Intronic
906769744 1:48472908-48472930 TAGGTTCTTTTTATCTTTGATGG - Intergenic
907455915 1:54575392-54575414 AAGGTTATTTTTACCCTTGGGGG + Intronic
909948089 1:81686445-81686467 AATGATCTTTTGTATTTTGGTGG + Intronic
910232985 1:85006057-85006079 AATGTTCTTTTGTACTTCTGTGG - Intronic
910418419 1:87027776-87027798 AAGAATCTCTTGAACTTAGGAGG - Intronic
910583612 1:88855440-88855462 AAGAATCTCTTGAACTTGGGAGG - Intronic
911259370 1:95667888-95667910 AATTTTCTTATGAATTTTGGCGG + Intergenic
911334302 1:96562540-96562562 AAAGTTCCTCTGAGCTTTGGGGG - Intergenic
911621513 1:100071098-100071120 AAAGTGCTTTTTAACTTTGGAGG + Intronic
912073324 1:105840705-105840727 AAGGTTCTTGGGAGATTTGGAGG + Intergenic
912787167 1:112615827-112615849 AAGAATCTCTTGAACTTGGGAGG - Intronic
912998550 1:114556125-114556147 AAGGTTTTTCTGAACTGGGGTGG - Intergenic
913045828 1:115072816-115072838 AAGCTGCACTTGAACTTTGGTGG - Intronic
915437230 1:155917112-155917134 AAGAATCTTTTTAACTTTAGTGG + Intronic
917970964 1:180207405-180207427 GAGGATCATTTGAACTTGGGAGG + Intergenic
919024035 1:192145431-192145453 GAGGATCTTTTGAACCTGGGAGG + Intergenic
919070479 1:192749197-192749219 TAAGTCCTTTTGAATTTTGGAGG - Intergenic
920606011 1:207386430-207386452 AATGATCTTTTGAATTTTTGTGG - Intergenic
920715527 1:208336681-208336703 ATGGTTCATTTGACCCTTGGTGG - Intergenic
921489498 1:215757258-215757280 AACTTTCTTTTGAATTTTAGGGG + Intronic
921593578 1:217030801-217030823 AAGATATTTTTGCACTTTGGAGG - Intronic
922927091 1:229358219-229358241 AATGATCTTTTGTATTTTGGTGG + Intergenic
923261369 1:232271105-232271127 AAAGGTCTTTGGAACTTTTGAGG + Intergenic
1062938738 10:1406569-1406591 ATGGGTCTTTCAAACTTTGGTGG + Intronic
1063705878 10:8430390-8430412 GAGGTTCTCTTGAACCCTGGAGG - Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064475001 10:15678609-15678631 AAGATTCTTTGGTTCTTTGGTGG + Intronic
1065012702 10:21433722-21433744 AAAGTTCTTCTGAGCTCTGGGGG - Intergenic
1065158786 10:22897331-22897353 AAAGTTCTTCTGAGCTCTGGGGG + Intergenic
1065898641 10:30185937-30185959 AAGTTTCTTTTCACCTTTTGGGG + Intergenic
1066007027 10:31154843-31154865 AATGTTTTTTTGGCCTTTGGAGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1066391882 10:34983628-34983650 AAGGATCGCTTGAACTTGGGAGG - Intergenic
1066747902 10:38620290-38620312 AAGGTTCTTAAGAATTTAGGTGG + Intergenic
1068618734 10:59153542-59153564 AAGGTACATTTAAGCTTTGGAGG - Intergenic
1068747720 10:60554106-60554128 AAGCTTATTTTGAACCCTGGTGG - Intronic
1069265862 10:66456584-66456606 AAGGATCATTTGAACCTGGGAGG + Intronic
1069534001 10:69239934-69239956 AATGTTCTTCCAAACTTTGGGGG + Intronic
1069657469 10:70100704-70100726 AAGAATCGTTTGAACTTGGGAGG - Intronic
1070521289 10:77255821-77255843 AAGAATCTCTTGAACTTGGGAGG + Intronic
1071303705 10:84278034-84278056 AAGAATCGTTTGAACTTGGGAGG + Intergenic
1072136683 10:92553665-92553687 AATGATCTTTTGAATTTTTGCGG - Intronic
1074994561 10:118745189-118745211 ATGGTTGTTTTGCTCTTTGGGGG - Intronic
1075624817 10:123954783-123954805 AACTTTCTATTAAACTTTGGAGG - Intergenic
1077543300 11:3157780-3157802 AAGGTTCTTCTGGCCGTTGGTGG + Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1077836777 11:5933202-5933224 TAGGGTCTTTAGAATTTTGGTGG - Intronic
1078076402 11:8165866-8165888 GAGGATCGTTTGAAGTTTGGAGG - Intronic
1078803644 11:14673303-14673325 AAGCTGCTTTTGAATGTTGGTGG - Intronic
1078906273 11:15690893-15690915 AAGGTCATTCTGAACCTTGGGGG + Intergenic
1079379585 11:19926038-19926060 AAGATTGTTTTGATTTTTGGGGG + Intronic
1079752242 11:24213490-24213512 AAACTTCATTTGAAATTTGGCGG + Intergenic
1080025951 11:27615420-27615442 AAGGTTCTCTTAAACTTCGTAGG - Intergenic
1080979242 11:37380419-37380441 AAGGATGTTTTGGATTTTGGAGG + Intergenic
1082052921 11:47787517-47787539 AAGAATCTCTTGAACTTGGGAGG - Intronic
1082702292 11:56447032-56447054 AATGTTCTTTCCAAGTTTGGTGG + Intergenic
1082730203 11:56786646-56786668 AAAGTTCTTTTCTCCTTTGGAGG - Intergenic
1082859888 11:57845551-57845573 AAAGATCTTTTGAACCTGGGAGG + Intergenic
1082898508 11:58219505-58219527 CAGGTTATTTTGAACTTTCTAGG - Intergenic
1083168711 11:60908932-60908954 AAAGTTCTTATGAGCTCTGGAGG + Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085120557 11:73964901-73964923 GAGGTAGATTTGAACTTTGGGGG + Exonic
1086814445 11:91351300-91351322 ATGGTTCTTTTACACTGTGGGGG - Intergenic
1087037361 11:93768787-93768809 AAAGTTATTTTGAACTCTGGGGG + Intronic
1087431416 11:98060742-98060764 TAGGTTCGTGTGAACTTTGAAGG - Intergenic
1088124271 11:106404770-106404792 AAGGATCACTTGAACTTGGGAGG - Intergenic
1088352710 11:108908265-108908287 AAAGTTGTTTTGAAGTTTAGTGG + Intronic
1089266756 11:117269297-117269319 AAGGTTCTTTTGAACTTTGGGGG + Intronic
1089592525 11:119553161-119553183 AAGGATCGCTTGAACTTGGGAGG + Intergenic
1090040687 11:123288613-123288635 AAGGATCGTTTGAACCTGGGAGG - Intergenic
1091721154 12:2815061-2815083 AAGGTTCGCTTGAACCTGGGAGG - Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092515813 12:9211554-9211576 ATGATTATTTTGAATTTTGGGGG + Intergenic
1094143698 12:27206828-27206850 AAGGTTCCTTTGGACTTTGGTGG - Intergenic
1094662343 12:32481729-32481751 AAGGATCTCTTGAACCTGGGAGG + Intronic
1095862491 12:46933520-46933542 AAGAATCGTTTGAACTCTGGAGG - Intergenic
1096954572 12:55512752-55512774 AATGTCCTTTTGGAATTTGGAGG - Intergenic
1097005100 12:55910949-55910971 AAGGTTCTTTTGAAGTCTTATGG + Intronic
1097695746 12:62773383-62773405 AAGGATCACTTGAACTTGGGAGG + Intronic
1098068388 12:66644488-66644510 AATCTTCTTTTGAGGTTTGGTGG - Intronic
1100397061 12:94194662-94194684 AAGGATCATTTGAACATAGGAGG + Intronic
1100515860 12:95327279-95327301 GAGAATCTTTTGAACTTGGGAGG - Intergenic
1101104451 12:101426112-101426134 GAGGTTCGTTTGAACCTGGGAGG - Intergenic
1101118498 12:101554856-101554878 AAGAATCTTTTGAACCTGGGAGG + Intergenic
1101632576 12:106509927-106509949 AAGATTCTTCTGAAACTTGGAGG + Exonic
1102017808 12:109659605-109659627 AAGGATCATTTGAGCTTGGGAGG + Intergenic
1102019032 12:109668914-109668936 AAGGTTCTCTTGAGCCTGGGAGG + Intergenic
1102619646 12:114183726-114183748 AAGATTCCTTTGAACCTGGGAGG + Intergenic
1102907246 12:116686424-116686446 GAGGATCTCTTGAACTTGGGAGG - Intergenic
1103524079 12:121556014-121556036 GAGGATCTCTTGAACTTGGGAGG - Intronic
1104251976 12:127103810-127103832 AAGAATCCTTTGAACCTTGGAGG + Intergenic
1104271351 12:127285239-127285261 AAGATTCCTGTGAACTTTGTAGG - Intergenic
1105905099 13:24801531-24801553 AAGGATCTCTTGAGCTTGGGAGG + Intronic
1107355146 13:39558411-39558433 AATGTCCTATTGAACTTTGCTGG - Intronic
1107536631 13:41341625-41341647 GAGGATCTCTTGAGCTTTGGAGG + Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1107847879 13:44536281-44536303 AATGTTATTTTTAATTTTGGGGG + Intronic
1108065871 13:46577184-46577206 GAGGATCATTTGAACTCTGGAGG - Intronic
1108284039 13:48887921-48887943 AAATTTTTTTTGAAGTTTGGTGG + Intergenic
1108348862 13:49572235-49572257 AAGGATCGTTTGAACCTGGGAGG + Intronic
1110421526 13:75314888-75314910 AAGGTTCTCTTGAACCCGGGAGG + Intronic
1112649609 13:101380011-101380033 CAGGTGCATTTGATCTTTGGGGG - Intronic
1115645252 14:35364814-35364836 AAGAGTCGTTTGAACTCTGGAGG + Intergenic
1115856953 14:37640307-37640329 CAGGTGCATTTGAATTTTGGAGG + Intronic
1117134586 14:52721853-52721875 GAGGATCATTTGAACTTGGGAGG - Intronic
1117577162 14:57110997-57111019 AAGATTCTTTTACATTTTGGAGG + Intergenic
1120120364 14:80671961-80671983 AAGGTGCTTTTAAACTTCAGAGG - Intronic
1120254677 14:82104021-82104043 AAGTTTCTATTGAATTTTAGGGG + Intergenic
1120477426 14:85005993-85006015 AAAGTTCCTTTGAGCTCTGGGGG + Intergenic
1120674945 14:87410351-87410373 AAAGTTTTTATAAACTTTGGTGG - Intergenic
1120878065 14:89392894-89392916 AAGAATCTCTTGAACCTTGGGGG - Intronic
1122184546 14:99980831-99980853 AATGTTATTTTGAATTTTGCTGG + Intronic
1126321122 15:47424994-47425016 AAGGTTCCTCTGAGCTCTGGAGG + Intronic
1127432516 15:58924598-58924620 AAGTTTCTTCTTAAGTTTGGTGG - Intronic
1128470226 15:67945624-67945646 AATATTTTTTTGAACCTTGGTGG + Intergenic
1129526553 15:76220154-76220176 AAGAATCATTTGAACTTGGGAGG - Intronic
1129612006 15:77068335-77068357 AAAGTTATTTTGAACTTCAGTGG - Intronic
1130168548 15:81487447-81487469 AAGCCACTTTAGAACTTTGGAGG + Intergenic
1130923011 15:88364933-88364955 GAGGTTTTCATGAACTTTGGAGG + Intergenic
1131785135 15:95904416-95904438 AAGATTCATTTGAACCTGGGAGG + Intergenic
1133885954 16:9827823-9827845 AGAGTTATTTTGCACTTTGGAGG - Intronic
1134144085 16:11746179-11746201 AAGAATCTTTTGAACCTGGGAGG - Intergenic
1134256376 16:12615303-12615325 AAGGTTCTCTTATACTTTGGGGG - Intergenic
1135095923 16:19564719-19564741 TAGTTTCTTTTTAACTTTGGTGG + Intronic
1135430377 16:22377383-22377405 AAGAATCCTTTGAACCTTGGAGG + Intronic
1135631878 16:24042072-24042094 AACTTTTATTTGAACTTTGGTGG + Intronic
1135776249 16:25259147-25259169 AAGGTTCTTTTGAAGTCTTATGG + Intergenic
1136315523 16:29452772-29452794 AAGAATCTTTTGAACCTGGGAGG + Intronic
1136430100 16:30192114-30192136 AAGAATCTTTTGAACCTGGGAGG + Intergenic
1136734861 16:32457010-32457032 AAGGTTCTTAAGAATTTAGGTGG - Intergenic
1138845295 16:60557773-60557795 AATGTGATTTTGAGCTTTGGGGG + Intergenic
1139722486 16:68867745-68867767 GAGAATCATTTGAACTTTGGAGG + Intronic
1140162898 16:72517524-72517546 GAGGATCGTTTGAACTTGGGAGG - Intergenic
1140720494 16:77767102-77767124 AAGGTCATTTAGAACTTGGGAGG + Intergenic
1140768673 16:78183400-78183422 AAGGTTTTCTTTGACTTTGGTGG + Intronic
1141545855 16:84768205-84768227 CAGATTCTTTTGAACTCTGCTGG - Exonic
1141793690 16:86254129-86254151 AAGGATCTTTTGAGCTCAGGAGG - Intergenic
1203018217 16_KI270728v1_random:372583-372605 AAGGTTCTTAAGAATTTAGGTGG + Intergenic
1203036552 16_KI270728v1_random:645741-645763 AAGGTTCTTAAGAATTTAGGTGG + Intergenic
1145893336 17:28434633-28434655 AGGGTTGTTTGGAAATTTGGAGG - Intergenic
1147182455 17:38695120-38695142 AAGGATCTCTTGAACCTGGGAGG - Intergenic
1147751101 17:42734135-42734157 AAGGATCGCTTGAACTTGGGAGG - Intronic
1148574464 17:48699720-48699742 GAGGATCGTTTGAACTTGGGAGG + Intergenic
1150257890 17:63763433-63763455 AAGGATCTCTTGAACCTGGGAGG + Intronic
1151501252 17:74490752-74490774 AAGGATCTATTGAGCTTGGGAGG - Intergenic
1151629286 17:75299345-75299367 AAGGTTCTCTTGAGCCTGGGAGG + Intergenic
1152981952 18:286860-286882 AAGGCTCATCTGGACTTTGGTGG + Intergenic
1155595664 18:27483089-27483111 AAAGTCTTTTTGAATTTTGGGGG - Intergenic
1155842531 18:30663579-30663601 GAGGATCTTTTGAACCTGGGAGG + Intergenic
1156295729 18:35789026-35789048 AAGGCTCATTTGAACCTGGGAGG - Intergenic
1157090391 18:44630144-44630166 CAAGTTCTTTTGAACTTTAGGGG - Intergenic
1157843426 18:50980418-50980440 AAGGTTCCTTTGGGCTTTTGGGG - Intronic
1158552205 18:58445861-58445883 AAGGATCTATTGAACTTAGTAGG + Intergenic
1158675969 18:59518399-59518421 AAGGATCACTTGAACTTGGGAGG + Intronic
1158740874 18:60140831-60140853 CAGGATCATTTGAACTTGGGAGG - Intergenic
1162096462 19:8312752-8312774 AAGGATCTCTTGAACCTGGGAGG - Intronic
1163050662 19:14680981-14681003 AAGGATCGTTTGAACTCAGGAGG + Intronic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164062639 19:21688988-21689010 TAGATTTTTTTGAACTTTTGGGG + Intergenic
1165457605 19:35922855-35922877 GAGGATCGTTTGAACTTGGGAGG - Intergenic
1165801787 19:38556390-38556412 GAGGATCTCTTGAACCTTGGAGG + Intronic
1166020820 19:40027564-40027586 AGGTTTCTTTTGACCTTTGGAGG + Intergenic
1166350246 19:42194667-42194689 AAGGATCTCTTGAACCTGGGAGG + Intronic
1166350524 19:42195867-42195889 AAGGATCTCTTGAACCTGGGAGG - Intronic
1167401711 19:49276175-49276197 AAGGTACTTTTAAAATTTGAGGG + Intergenic
1168244467 19:55104611-55104633 AAGGATCTCTTGAATCTTGGAGG + Intronic
926317647 2:11723115-11723137 ACAGTGCTTTTGAACTTTGATGG - Intronic
927264491 2:21129685-21129707 AAGTTTTTTTTAAACTTTGATGG + Intronic
928008443 2:27583923-27583945 AAGGTTCTTTTGTGATTTTGTGG + Intronic
928614092 2:33019133-33019155 AAGCTTGTTTTGAACTTTATGGG + Intronic
928745258 2:34406331-34406353 AAGGTTCTTATTAAATTTGATGG + Intergenic
929774775 2:44922281-44922303 ATGGTGATTTTGAACCTTGGAGG + Intergenic
929799979 2:45091674-45091696 AAGAATCTCTTGAACCTTGGAGG + Intergenic
930255923 2:49091391-49091413 AAGGATCACTTGAACTTGGGAGG - Intronic
930525281 2:52521364-52521386 AAGGGTCTTTTATACTCTGGTGG + Intergenic
930726040 2:54682501-54682523 AAGAATCGTTTGAACTTGGGAGG - Intergenic
930747775 2:54902487-54902509 AAGGATCACTTGAGCTTTGGAGG - Intronic
931559024 2:63536853-63536875 AAGAATCATTTGAACTTGGGAGG - Intronic
931698380 2:64889215-64889237 AAAGTCCTGTTGAACTCTGGGGG - Intergenic
932289099 2:70560184-70560206 ATGATTTTTTTTAACTTTGGAGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
933464086 2:82628129-82628151 AAATTTCTTTTGAATTTTGGGGG - Intergenic
933834847 2:86237610-86237632 AAGAATCTTTTGAACCTGGGAGG - Intronic
934310868 2:91862436-91862458 AAGGTTCTTAAGAATTTAGGTGG + Intergenic
935723507 2:106000443-106000465 GAGGATCGTTTGAACTTGGGAGG + Intergenic
936164718 2:110110400-110110422 AATGATCTTTTGTATTTTGGTGG - Intronic
937636211 2:124158062-124158084 AAGGGTCTTGTTAACATTGGTGG + Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941177996 2:162223080-162223102 AATGTTCTTTTGAATTTAGTTGG - Intronic
942284528 2:174402019-174402041 AAGGTAGCCTTGAACTTTGGAGG + Intronic
942745217 2:179224548-179224570 AAGGCTCTTTTGAAGGATGGGGG + Intronic
943205745 2:184892572-184892594 GAGGTTCGCTTGAACCTTGGAGG - Intronic
943232977 2:185279721-185279743 TAGTTTCTTTTTAACTTTGCAGG + Intergenic
944964629 2:204916311-204916333 ATGGTTGTTTTGAACTTTATAGG + Intronic
945311516 2:208318859-208318881 AAGAATCTCTTGAACCTTGGAGG + Intronic
945599449 2:211840572-211840594 AAGGTTCTTCAGAACTATTGAGG + Intronic
945622661 2:212160438-212160460 AAGGTTTTATTTAACTATGGAGG - Intronic
946272187 2:218603624-218603646 AAGAATCGTTTGAACTTGGGAGG - Intergenic
946599999 2:221349218-221349240 AAGGATCATTTGAACCTAGGAGG - Intergenic
946735251 2:222747560-222747582 CAGGATCTTTTTTACTTTGGTGG - Intergenic
947388376 2:229615319-229615341 AAGAATCGTTTGAACCTTGGAGG + Intronic
947412917 2:229861178-229861200 AATGTTTTTTGGAACTTTTGTGG - Intronic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947683900 2:232063189-232063211 ATGGTTCCTTTGAAAGTTGGAGG + Intronic
948016356 2:234693944-234693966 AAGGTTCTTTTGAAGTCTTATGG - Intergenic
948832687 2:240605917-240605939 AAGGGTCTTTTCTGCTTTGGAGG + Intronic
949056520 2:241930931-241930953 AAGGTTCTGGAGAACTATGGTGG - Intergenic
1169391863 20:5197211-5197233 AAGGATCTTGGGAACCTTGGTGG + Exonic
1169618865 20:7481695-7481717 ATGGTTTTTTTTAACTTAGGGGG - Intergenic
1169671072 20:8103051-8103073 GAGGATCTTTTGTATTTTGGTGG + Intergenic
1169690932 20:8331166-8331188 AAGGTTTTATTGTTCTTTGGAGG - Intronic
1170010331 20:11715830-11715852 AAGGATCTTTTGAACCCGGGAGG - Intergenic
1170381484 20:15764636-15764658 AATGATGTTTTGAACTATGGTGG - Intronic
1171124040 20:22586553-22586575 AACATTCTTTTGAGTTTTGGGGG - Intergenic
1171327313 20:24305863-24305885 AATATTCTTTAGAAGTTTGGGGG - Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1172071213 20:32258636-32258658 AAGAATCACTTGAACTTTGGAGG + Intergenic
1172311854 20:33924586-33924608 AAATTCCTTTTGAAGTTTGGGGG - Intergenic
1175555274 20:59848982-59849004 ACTGATCTTTTGTACTTTGGGGG - Intergenic
1177211464 21:18076975-18076997 AGGGTTGTTTGGAACCTTGGCGG + Intronic
1178551767 21:33546420-33546442 AAGATTTTTTTGAAATTTGAAGG + Intronic
1178789217 21:35683105-35683127 AAGGAACTTTGGAACTTTAGAGG + Intronic
1178791873 21:35707677-35707699 GAGGATCTTTTGAACCTGGGAGG + Intronic
1178911230 21:36675217-36675239 AAGGATCATTTGAACGTGGGAGG - Intergenic
1178974670 21:37210613-37210635 AACGGTCTTTTGAAATTTTGAGG + Intergenic
1179020367 21:37635306-37635328 AAGGATCTCTTGAACCTGGGAGG - Intronic
1180537623 22:16408366-16408388 AAGGTTCTTAAGAATTTAGGTGG + Intergenic
1180943162 22:19673510-19673532 AAGAATCTCTTGAACTTGGGAGG - Intergenic
1181350717 22:22255955-22255977 AAGAATCTTTTGAACCTGGGAGG + Intergenic
1181405260 22:22679902-22679924 CAGGGTCTTTTGAGCTCTGGAGG + Intergenic
1181562056 22:23710854-23710876 CAGGTTCTTTGGGTCTTTGGTGG - Intergenic
1182390745 22:29993312-29993334 ATGGCTCTTTTCAAATTTGGGGG + Intronic
1184171413 22:42761891-42761913 AAGAATCGCTTGAACTTTGGAGG - Intergenic
1184904760 22:47473646-47473668 AAGATTCACTTGAACCTTGGAGG + Intronic
1184908832 22:47511901-47511923 ATCTTTCTTTTGAACTTTGAGGG + Intergenic
949629681 3:5910863-5910885 AAGGATCTTTTGTACTTCTGTGG + Intergenic
949911491 3:8913186-8913208 AATATTCTCTTGAGCTTTGGAGG - Intronic
950403164 3:12786624-12786646 GAGGATCTCTTGAACTTGGGAGG + Intergenic
950571940 3:13806635-13806657 AAGGATCTCTTGAACTAAGGAGG - Intergenic
950738342 3:15029626-15029648 AAGATAATTTTTAACTTTGGAGG + Intronic
951669443 3:25163827-25163849 ATGTTTCTTTTGACCTTAGGAGG + Intergenic
952345681 3:32482458-32482480 CAGGTCCTTCTGCACTTTGGTGG - Exonic
952822877 3:37499942-37499964 AAGGCTCTTCGGAACATTGGGGG - Intronic
953335069 3:42087513-42087535 CAGAGTCTTTTGCACTTTGGTGG - Intronic
954775634 3:53015117-53015139 AAGGATCATTTGAACTCAGGAGG + Intronic
954809421 3:53238893-53238915 AGGGTTCCTTTGCCCTTTGGGGG - Intronic
955856761 3:63280431-63280453 AAGGGGCTTTTGAGTTTTGGAGG - Intronic
956096370 3:65720837-65720859 GAGGTTCTCTTGAACCTGGGAGG - Intronic
956349887 3:68322851-68322873 AAGAATCTCTTGAACCTTGGAGG + Intronic
956494171 3:69806448-69806470 AAGGTTTTTTTTAACTTTGGGGG + Intronic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957350389 3:79017324-79017346 AAGGTTAGTTTGAGCTTTTGTGG - Intronic
958134646 3:89472651-89472673 AGGATTCTTTTGAACTTTCTTGG + Intronic
959115425 3:102171963-102171985 ATGGTTGTTTTGTACTTTTGGGG - Intronic
960243821 3:115377437-115377459 AGGGTTCTTTTGATCTTTGCAGG - Intergenic
960450724 3:117804137-117804159 TATGTTCTTTAGAAATTTGGAGG - Intergenic
960704990 3:120473318-120473340 ACGGTTCTTTGGCACTTTTGAGG + Intergenic
961181399 3:124881071-124881093 GAGGATCGCTTGAACTTTGGAGG - Intronic
961693527 3:128687919-128687941 AAGAATCTTTTGAACTCAGGAGG - Intergenic
962815630 3:138995403-138995425 AAGGATCGTTTGAACCTGGGAGG - Intergenic
963802561 3:149691490-149691512 AATGATCTTTTGAACTTCTGTGG - Intronic
966287408 3:178313746-178313768 AAGGTTTTTTTGAACATAGAGGG - Intergenic
966709406 3:182955671-182955693 CAGGTTCACTTGAACTTGGGAGG - Intronic
967217498 3:187222970-187222992 AAAGTCCCATTGAACTTTGGAGG + Intronic
967521581 3:190438833-190438855 AAGGTGCTTTTGATTTTAGGAGG + Intronic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
971032377 4:22653676-22653698 AATGTTCCTTGTAACTTTGGGGG - Intergenic
971216132 4:24663809-24663831 AAGGATCGTTTGAGCTTGGGAGG - Intergenic
972470659 4:39400935-39400957 AAGAATCGTTTGAACCTTGGAGG - Intergenic
972729430 4:41778918-41778940 GAGGGTCTCTTGAGCTTTGGAGG + Intergenic
972864055 4:43208592-43208614 AAGGATCTCTTGAGCCTTGGAGG - Intergenic
975106917 4:70578082-70578104 GAGGTTCTCTTGAACATGGGAGG - Intergenic
976323111 4:83738429-83738451 GAGGTTCACTTGAACCTTGGAGG - Intergenic
977851697 4:101838047-101838069 AAGAATCATTTGAACTCTGGAGG - Intronic
977944026 4:102890386-102890408 AAGGTTCTTAAGAATTTAGGTGG + Intronic
979388913 4:120103626-120103648 AGGGTTGTTTTGAGCATTGGAGG - Intergenic
979623141 4:122818138-122818160 AAGGATCATTTGAACCTGGGAGG + Intergenic
979689192 4:123542630-123542652 GAGGATCTTTTGAACCTTGGAGG + Intergenic
980038703 4:127914410-127914432 AAGGATCGTTTGAGCTTGGGAGG - Intergenic
982490386 4:156022477-156022499 AAAGTTCTTCTGAGCTCTGGGGG + Intergenic
983391736 4:167140736-167140758 AAAGTTTTTCTGAACTCTGGGGG - Intronic
983758415 4:171372514-171372536 AACGTTCATGTGAACTTTGTAGG - Intergenic
987462784 5:18233413-18233435 AAGGATGTCTTGAATTTTGGAGG - Intergenic
987864290 5:23520273-23520295 AAGAATCTCTTGAACTTGGGAGG + Intronic
988481435 5:31634731-31634753 TAGATTCTTTTGGACTGTGGTGG - Intergenic
988561484 5:32285585-32285607 CAGTTTCTTTTGAACTGTAGGGG - Intronic
989063726 5:37437269-37437291 AATTTTCTTTTTAACTTTGAAGG + Intronic
989190222 5:38663659-38663681 AAATTTCTTTTGGACTTTGAAGG - Intergenic
989384432 5:40840417-40840439 CAGGTTCTTGTGAACTATGAAGG + Intergenic
989568669 5:42925246-42925268 AAGGTCCCTTTGAACTAGGGAGG - Intergenic
991052242 5:62285667-62285689 AAGATTCTTGAGAAATTTGGAGG + Intergenic
992121301 5:73595592-73595614 AAGAATCTTTTGAACCTGGGAGG - Intergenic
992157800 5:73972066-73972088 CAGGTTCTTTTGTACTATGATGG + Intergenic
992260809 5:74968181-74968203 AAGAATCTCTTGAACTTGGGAGG - Intergenic
992785248 5:80164159-80164181 AATGATCTTTTGTACTTTTGTGG + Intronic
993598476 5:89889565-89889587 GAGGTTCTAGTGAACATTGGAGG + Intergenic
994428981 5:99631375-99631397 AATTTTCTTTTGACCTTTGGGGG + Intergenic
995317824 5:110796815-110796837 CAGGTTCTTTTGTCCTTTGGGGG + Intergenic
995473833 5:112528659-112528681 AAGGTCCTGTTAAACTCTGGGGG + Intergenic
996000725 5:118360082-118360104 AAGAGTCTTTTGAAATTTGTTGG - Intergenic
996057450 5:118997217-118997239 ATGTCTCTTTTGAACTTTAGGGG + Intergenic
996795410 5:127341401-127341423 AAGGTTCTGCTGTAATTTGGAGG + Intronic
997169574 5:131702657-131702679 AAGGTTTTTTAGAAATTTGGGGG - Intronic
998576759 5:143325060-143325082 AAGCGACTTTGGAACTTTGGAGG - Intronic
998663804 5:144272499-144272521 AAGGTTGTTTTGGCTTTTGGGGG - Intronic
998854608 5:146382288-146382310 AAGGATCACTTGAACTTGGGAGG - Intergenic
999158413 5:149474957-149474979 GAGAATCTTTTGAACTTGGGAGG - Intergenic
999335479 5:150712515-150712537 AAGGATCATTTGAGCTTAGGAGG - Intronic
999508385 5:152222096-152222118 GAGGTTCTTATAGACTTTGGGGG + Intergenic
999869529 5:155734691-155734713 GGGAATCTTTTGAACTTTGGGGG + Intergenic
1001488162 5:172134832-172134854 AAGGATCATTTGAGCTTGGGAGG + Intronic
1003204811 6:3998570-3998592 ATCGTTATTTTGAACTGTGGTGG + Intergenic
1003478186 6:6504729-6504751 GAGGTTATTTAGAACTGTGGGGG - Intergenic
1003485464 6:6572815-6572837 AAGATTGTTTTGGATTTTGGGGG + Intergenic
1003488918 6:6604032-6604054 AAGATTTTTTTGAACTATGAAGG - Intronic
1003877483 6:10451354-10451376 ATGGTTCTTTTGGGCTTTGATGG - Intergenic
1005075164 6:21899693-21899715 GGGGTTCTTTTGAAGTTTGCAGG - Intergenic
1005246828 6:23895722-23895744 AAGAATCTTTTGAACCTGGGAGG - Intergenic
1005523261 6:26619383-26619405 AAGGATCGCTTGAACTTGGGAGG + Intergenic
1005696741 6:28358792-28358814 AAGAATCTTTTGAACATGGGAGG + Intronic
1007555395 6:42761357-42761379 GAGGATCTCTTGAACTTGGGAGG + Intronic
1007909475 6:45499175-45499197 GTGGTTCTTTTTTACTTTGGTGG + Intronic
1007989374 6:46239384-46239406 GAGCTCCTATTGAACTTTGGTGG + Intronic
1010291707 6:74145316-74145338 AAGGATGTTTAGAACTTTGAGGG - Intergenic
1010446251 6:75951850-75951872 AAGAATCTCTTGAACTTGGGAGG + Intronic
1010901146 6:81429230-81429252 TAGGTTTTTTTTAATTTTGGGGG + Intergenic
1012423414 6:99089168-99089190 AAACTTCTATTGAACTTTTGAGG - Intergenic
1012707686 6:102552887-102552909 AATGTGATTTTTAACTTTGGAGG + Intergenic
1014166787 6:118233911-118233933 AAGGGTCTCTTGACCTTTGGTGG - Intronic
1014207681 6:118673956-118673978 AATGTTCTTTTGAATCTTGTTGG - Intronic
1014361117 6:120475689-120475711 ATGGTTCTTTTTAAATTTGGTGG + Intergenic
1016455961 6:144231026-144231048 AAGTTTCTTTAGAACATTGAAGG + Intergenic
1016798233 6:148140962-148140984 AAGTTTCATTTGAAGTATGGTGG - Intergenic
1017997617 6:159546478-159546500 CAGGGCCTTTTGGACTTTGGTGG - Intergenic
1018728224 6:166629415-166629437 ACTGTTCTGTTGAACTTGGGAGG + Intronic
1019386690 7:761002-761024 ACTTTTCTTTTTAACTTTGGAGG + Intronic
1019722324 7:2580520-2580542 AAGGATCACTTGAACTTGGGAGG + Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1021035230 7:15789947-15789969 AATGATCCTTTGAATTTTGGTGG - Intergenic
1021315163 7:19139968-19139990 AAGGTGCTTTTGATCTTTGAAGG + Intergenic
1021352398 7:19611165-19611187 AATTTTCTTTTGAATTTCGGTGG + Intergenic
1021395098 7:20138061-20138083 AAGGATCTTTTGAACCCAGGAGG + Exonic
1022555045 7:31285153-31285175 ATGGTTGTTTTGCAATTTGGGGG - Intergenic
1023039513 7:36160075-36160097 AAGGTTCTTTGGGAGTTTGATGG + Intronic
1023762801 7:43482571-43482593 TGGCTTCTTTTGAACTTTTGTGG - Intronic
1025224483 7:57144866-57144888 GAGGATCTTTTGAACTTGGGAGG - Intergenic
1025796620 7:64743766-64743788 GAGAATCATTTGAACTTTGGAGG + Intergenic
1027125990 7:75557126-75557148 AAGAATCTCTTGAACCTTGGAGG - Intronic
1027772237 7:82421475-82421497 AGGGTTCCTTTGAATTTTAGAGG + Intronic
1028699805 7:93764239-93764261 CAGGATCTTTAGAACTTTGTAGG - Intronic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1030471493 7:109968992-109969014 TGGGGTCTTTTGAAATTTGGAGG - Intergenic
1030839012 7:114324896-114324918 AATGTTCTTTTTAATTTTTGTGG + Intronic
1031146187 7:117999832-117999854 AAGTCTCTTTTGAACTTTTTGGG + Intergenic
1031338336 7:120566430-120566452 GAGGATCTCTTGAACTTGGGAGG - Intronic
1031965889 7:128028056-128028078 AGGGTTCGTTTGAATTTTGGTGG + Exonic
1032547272 7:132754419-132754441 AAGGATCTCTTGAACCTGGGAGG + Intergenic
1033054584 7:138038485-138038507 ATGTCTCTTTTGGACTTTGGGGG - Intronic
1033081388 7:138301743-138301765 GAGGTTCTTTTGAGCTCAGGAGG - Intergenic
1033680268 7:143586769-143586791 TTGGTTCTTTTGACCTTTGTTGG - Intergenic
1033691571 7:143742673-143742695 TTGGTTCTTTTGACCTTTGTTGG + Intergenic
1035343042 7:158176769-158176791 ATTGTTCTTATGACCTTTGGTGG - Intronic
1035410914 7:158640441-158640463 AAGAATCGTTTGAACTTAGGAGG + Exonic
1036114275 8:5941599-5941621 AAGGATATAATGAACTTTGGAGG + Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1036960541 8:13240360-13240382 CAAGATCTTTTTAACTTTGGTGG + Intronic
1037089794 8:14899677-14899699 CAGGTTCTTTTGACCTCGGGAGG + Intronic
1037261788 8:17017957-17017979 AAGGATCTCTTGAACCTTGGAGG - Intergenic
1038310432 8:26442140-26442162 AAGAATCTCTTGAACTTGGGTGG - Intronic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039487876 8:37926198-37926220 GAGGTTCACTTGAACTTGGGAGG - Intergenic
1040823226 8:51588839-51588861 AAGGATCCTTCAAACTTTGGGGG - Intronic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1041148949 8:54911771-54911793 AAGGATCACTTGAACTTAGGAGG - Intergenic
1041239826 8:55839869-55839891 AAGGATCGCTTGAACTTGGGAGG + Intergenic
1042015226 8:64301894-64301916 AAGGTTCTTTTAAATTTGTGTGG - Intergenic
1042758811 8:72249288-72249310 AAGGGTTTTTTGAACTCTAGAGG - Intergenic
1044315281 8:90743446-90743468 AAGGATCTCTTGAGCTTGGGAGG + Intronic
1045477504 8:102565681-102565703 CAGAATCTTTTGAACTTGGGAGG + Intergenic
1046718395 8:117592153-117592175 AAGAATCTTTTGAACCTGGGAGG - Intergenic
1047728238 8:127703402-127703424 AAGAATCGTTTGAACTCTGGAGG - Intergenic
1050617399 9:7416526-7416548 GAGGTTCTTTTGAACTTTTCTGG - Intergenic
1050799288 9:9589365-9589387 AAGGTTCTTGTTAACTCTTGTGG + Intronic
1051030196 9:12665572-12665594 AAGGATCCTTTGAACCTGGGAGG - Intergenic
1052215664 9:25963370-25963392 AAGTTTCTTTTCTAATTTGGGGG + Intergenic
1052667361 9:31512290-31512312 AAAGTTTGTTTGAACTTTGGGGG - Intergenic
1053379011 9:37633769-37633791 AAGGATCATTTGAGCTTGGGAGG + Intronic
1055618254 9:78095621-78095643 AAGGATCTCTTGAACCTGGGAGG - Intergenic
1055694992 9:78873843-78873865 AAGAATGTCTTGAACTTTGGAGG + Intergenic
1056348805 9:85726693-85726715 AAGTGTCTTTTGAATTTTGCTGG - Intronic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1056944512 9:90983214-90983236 AAGAATCTCTTGAACTTGGGAGG - Intergenic
1057722158 9:97541275-97541297 GAGGATCCTTTGAACTTAGGAGG - Intronic
1059834438 9:118134965-118134987 CAGGTCCTGCTGAACTTTGGGGG + Intergenic
1060097303 9:120803355-120803377 GAGGATCTATTGAACTTGGGAGG - Intergenic
1060448328 9:123712943-123712965 AAGGCCCATTTGTACTTTGGGGG - Intronic
1060568964 9:124619969-124619991 AAGAATCGTTTGAACTTGGGAGG + Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1185617946 X:1434703-1434725 AAGGATCACTTGAACTTGGGAGG + Intronic
1186727522 X:12372989-12373011 GAAGTCCTTTAGAACTTTGGGGG + Intronic
1187545254 X:20245261-20245283 AAGGTTATTTAAAATTTTGGGGG + Intronic
1187721641 X:22156970-22156992 AAGGATCACTTGAACTTGGGAGG - Intronic
1187812313 X:23192790-23192812 AAGGTTCTTTCCAAATCTGGTGG + Intergenic
1189597841 X:42588942-42588964 GAGGATCTTTTGTATTTTGGTGG - Intergenic
1190865158 X:54378297-54378319 GAGGATCTCTTGAACTCTGGAGG - Intergenic
1192628668 X:72757239-72757261 GAGGTTCTTTTGAACTTTTCTGG + Intergenic
1192653040 X:72963575-72963597 GAGGTTCTTTTGAACTTTTCTGG - Intergenic
1193140383 X:78020600-78020622 AAGGATCGCTTGAACTTAGGAGG - Intronic
1193154983 X:78162515-78162537 AATGATCTTTTGTATTTTGGTGG - Intergenic
1193190139 X:78561514-78561536 CTGTTGCTTTTGAACTTTGGTGG + Intergenic
1194097718 X:89664014-89664036 AATGATCCTTTGAATTTTGGTGG + Intergenic
1194119473 X:89943039-89943061 AAGGTTTTATTGAATGTTGGAGG - Intergenic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1195503110 X:105626213-105626235 AAGGGTGTTTTGAATTTTTGAGG + Intronic
1195544400 X:106099281-106099303 AAGCTTATTTTCAACTTTTGAGG + Intergenic
1195693029 X:107644648-107644670 AAGCTTCTGTTGAGCTATGGAGG + Intronic
1198098528 X:133403783-133403805 AAGGATTGTTTGAACTTGGGAGG - Intronic
1198130702 X:133692036-133692058 AAGGATCATTTGAACCTGGGAGG - Intronic
1199032666 X:143018683-143018705 AATGATCTTTTGAATTTTTGTGG - Intergenic
1200450738 Y:3325388-3325410 AATGATCCTTTGAATTTTGGTGG + Intergenic
1200709403 Y:6470031-6470053 GAGGTTTTTTTGCACTTTGCAGG - Intergenic
1200761627 Y:7044301-7044323 GAGGATCATTTGAGCTTTGGAGG - Intronic
1201024709 Y:9694677-9694699 GAGGTTTTTTTGCACTTTGCAGG + Intergenic
1201555107 Y:15259043-15259065 AAGGGTCTGTTAAACTCTGGGGG + Intergenic
1201965106 Y:19724186-19724208 AAGGGACTTTTGGAGTTTGGAGG + Intronic
1201970235 Y:19784746-19784768 GAGGCTCTTTTGTACTTTTGTGG - Intergenic
1202056335 Y:20835335-20835357 AAGGTTATAATGAACTCTGGGGG + Intergenic