ID: 1089275969

View in Genome Browser
Species Human (GRCh38)
Location 11:117336384-117336406
Sequence CGGTGGGTATGGAGGAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 4, 2: 2, 3: 27, 4: 351}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089275951_1089275969 23 Left 1089275951 11:117336338-117336360 CCATGCCAGGAGCCAAGAGATTC 0: 1
1: 2
2: 2
3: 14
4: 166
Right 1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG 0: 1
1: 4
2: 2
3: 27
4: 351
1089275956_1089275969 11 Left 1089275956 11:117336350-117336372 CCAAGAGATTCACAGGAGGGATT 0: 1
1: 2
2: 5
3: 22
4: 175
Right 1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG 0: 1
1: 4
2: 2
3: 27
4: 351
1089275952_1089275969 18 Left 1089275952 11:117336343-117336365 CCAGGAGCCAAGAGATTCACAGG 0: 1
1: 3
2: 3
3: 37
4: 455
Right 1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG 0: 1
1: 4
2: 2
3: 27
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089275969 Original CRISPR CGGTGGGTATGGAGGAAGGT GGG Intronic
900099579 1:955881-955903 AGGGGGGTAGGGTGGAAGGTGGG - Intronic
900497968 1:2985028-2985050 TGGTGGGTCTGGAGGAGGTTGGG - Intergenic
900848185 1:5120635-5120657 AGGTGGGTGTGGAGGTGGGTAGG - Intergenic
902322163 1:15675683-15675705 AGGTAGGTATGTAGGTAGGTAGG - Intergenic
902322187 1:15675794-15675816 AGGTAGGTATGTAGGTAGGTAGG - Intergenic
902689507 1:18101366-18101388 CGGTTGGAAGGGAGGAAGGAAGG - Intergenic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903651494 1:24925250-24925272 CGGTTGGCAGGGAGGAAGGAGGG - Intronic
904068525 1:27773778-27773800 AGGTGGGTGGGGAGGAAGGTGGG - Intronic
904212902 1:28897547-28897569 AGGTAGGTAGGTAGGAAGGTAGG + Intronic
904831218 1:33307696-33307718 AGGTGGGGATGGAGTGAGGTTGG - Intronic
904853023 1:33473245-33473267 CAGTGGGTAAGTAGGTAGGTAGG - Intronic
905011702 1:34751546-34751568 AGGTGGGAAGGGTGGAAGGTGGG - Intronic
905239861 1:36574543-36574565 CGCTGGGGATGGGGGAAGCTGGG - Intergenic
905694899 1:39967065-39967087 AGCTGGGCATGGAGCAAGGTAGG - Exonic
906944783 1:50286428-50286450 CAGTGGGTAGAGTGGAAGGTAGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
909618402 1:77639065-77639087 CGGTAGGTAGGTAGGTAGGTAGG + Intronic
911950555 1:104168573-104168595 GGGTTGGGTTGGAGGAAGGTAGG + Intergenic
913272938 1:117111793-117111815 AGCTGGGTGTGGGGGAAGGTGGG + Exonic
915288517 1:154867944-154867966 GAGTGGAGATGGAGGAAGGTGGG - Intronic
915597978 1:156906180-156906202 CCCTGGTTTTGGAGGAAGGTGGG + Intronic
916288355 1:163135773-163135795 GGGTGGGGTTGGAGGAAGGGAGG - Intronic
916364421 1:164008329-164008351 AGGGTGGTATGGAGGCAGGTAGG + Intergenic
916417213 1:164603068-164603090 GAGTGGGTATGGAAGAAGGAAGG - Intronic
916959915 1:169878937-169878959 TAGTGGGTAGGGAGGAAGGTAGG - Intronic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
917850860 1:179062836-179062858 GGGTAGGTATAGAGGAAGGGGGG - Intronic
918271004 1:182899345-182899367 AGGTAGGTATGTAGGTAGGTAGG - Intergenic
919490281 1:198197949-198197971 TGGTGGGTATGGAGGAGGGTAGG + Intronic
920375217 1:205504637-205504659 GGGAGGGAGTGGAGGAAGGTGGG - Exonic
920538410 1:206758038-206758060 CGGTGGGTACAGAAGCAGGTTGG - Intergenic
920887041 1:209938699-209938721 AGGTGGGTATTGCGGAAGGATGG - Intronic
921556058 1:216600422-216600444 GGGAGGGTATGGATGAAGGGGGG + Intronic
922000259 1:221470140-221470162 AGGTGGGTAGGGAGCAAGGAGGG + Intergenic
922201788 1:223409229-223409251 GGGTGGAAATGGAGGAAAGTGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924181276 1:241440635-241440657 CGGTGGGGAGGGAGGGAGGGAGG + Intergenic
924286978 1:242497476-242497498 GTGTGTGTATGGAGGCAGGTGGG + Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924603579 1:245513131-245513153 AGGAGGGTGTGGAGGAGGGTGGG - Intronic
924946297 1:248849149-248849171 ATGTGGGTATGGAGGTGGGTGGG + Exonic
1062938172 10:1403102-1403124 AGGTGGGGATGGAGAAAGGCCGG + Intronic
1063264649 10:4434427-4434449 CTGGGGGTATGCAGGAGGGTGGG - Intergenic
1064779846 10:18822948-18822970 GGGTGGTTCTGGAGGAAGGAAGG + Intergenic
1067270516 10:44787815-44787837 CTCTGGGCATGGAGGAAGGTAGG - Intergenic
1069562274 10:69439310-69439332 CTGTGGCTATAGAGGAAGGTGGG - Intergenic
1070577350 10:77689266-77689288 AGGTGGGAAGGGAGGAAGGGAGG - Intergenic
1072280862 10:93863956-93863978 CAGTGGTTATGGAGGATGGGAGG + Intergenic
1072374911 10:94804361-94804383 CAGTTGGTCTGGAGGAAGGTAGG - Intronic
1072924020 10:99600344-99600366 CCCTGGGTATGGTGGGAGGTAGG - Intergenic
1074761388 10:116669811-116669833 AGGTGGGCAGGGAGGAGGGTGGG + Intronic
1076764848 10:132627405-132627427 AGGTGGGTCTGGAGGGCGGTGGG + Intronic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077086236 11:752876-752898 GGGTGGGAATGGAGAATGGTTGG + Intronic
1077440323 11:2565873-2565895 CACTGGGTCTGGAGGAAGGAGGG + Intronic
1078215856 11:9311441-9311463 CGGTGGGTATGGAGGAGGGTAGG + Intronic
1079978928 11:27128533-27128555 CAGTGACTATGGAGGAAGCTGGG - Intergenic
1081742343 11:45449398-45449420 GGGTGGGTGTGTAGGCAGGTGGG + Intergenic
1081877533 11:46419808-46419830 AGGTGGGGAGGGAGGAAGGCAGG + Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1082892489 11:58155016-58155038 AGGTAGGTAGGCAGGAAGGTAGG - Intronic
1084172063 11:67405572-67405594 CTGTGGGTAGCCAGGAAGGTGGG - Intronic
1084198042 11:67537073-67537095 AGGTGGGAATGGAGGTAGGCAGG - Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085339181 11:75720169-75720191 CGGTGAGTATTGAGGCTGGTTGG + Exonic
1085511718 11:77091594-77091616 CTGTGGGTATGGTGGAGGGTGGG - Intronic
1086496104 11:87405953-87405975 TTTTGGATATGGAGGAAGGTAGG + Intergenic
1086547574 11:88015950-88015972 TGGTGGATATGGTGGAAGGATGG - Intergenic
1087624372 11:100580239-100580261 GGGTGTGTAGGGAAGAAGGTAGG - Intergenic
1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG + Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1092597433 12:10022871-10022893 CCTTGGGAACGGAGGAAGGTGGG + Intergenic
1093863289 12:24194423-24194445 AGGTAGGTATGTAGGTAGGTAGG + Intergenic
1096519244 12:52174831-52174853 GGGTGTGTAGGGAGGCAGGTGGG + Intronic
1096604922 12:52757835-52757857 AGGTGGGTGTGGAGGCAGGCAGG - Intergenic
1096709315 12:53443598-53443620 CGGTGGGTATGGAGGAGGGTAGG - Exonic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1100137106 12:91566976-91566998 AGGTGGGAAGGAAGGAAGGTGGG - Intergenic
1101248873 12:102911703-102911725 CTGTGGGTGGGGAGGAAGATGGG - Intronic
1101682558 12:106983965-106983987 AGGTGGGTATGGAGGTAGGTGGG - Intronic
1101761324 12:107661193-107661215 AGGTGGGGGTGGAGGGAGGTGGG - Intergenic
1102422352 12:112814001-112814023 TGGTGGGTATGGAGTAAACTAGG + Intronic
1103030165 12:117606484-117606506 AGGAGGGGATGGAGGAAGGAAGG - Intronic
1104310964 12:127654015-127654037 CGAAGGTCATGGAGGAAGGTGGG - Intergenic
1104731754 12:131108989-131109011 AGGTGGGGATGGGGGGAGGTGGG + Intronic
1106478777 13:30120784-30120806 TGGTGGGGATGTAGGAATGTTGG + Intergenic
1106485693 13:30170808-30170830 CGGTGGGTATGAAGGCCGGGAGG - Intergenic
1107044000 13:35976170-35976192 GGGTGGGTTTGGAGGCAGGTTGG + Intronic
1107071348 13:36272947-36272969 TGGCAGGTATGGAAGAAGGTGGG - Intronic
1107456913 13:40563595-40563617 TCTTGGGTGTGGAGGAAGGTGGG - Intronic
1108131136 13:47301852-47301874 AGGTAGGTATGTAGGTAGGTAGG - Intergenic
1112786929 13:102961409-102961431 AGGTAGGTAGGTAGGAAGGTAGG - Intergenic
1113911062 13:113841527-113841549 CGGGGCGTATGGAGGAAACTGGG - Intronic
1114532152 14:23402905-23402927 CGGGGTGAATGGAGGAAGGGAGG + Intronic
1115668237 14:35578041-35578063 AGGTGGATATGGAGGAGGGAAGG - Intronic
1116338125 14:43685835-43685857 AGGTGGGTAGGTAGGTAGGTAGG + Intergenic
1118072463 14:62260828-62260850 AGGTGGGTAGGTAGGTAGGTAGG - Intergenic
1118469386 14:66061063-66061085 GGGTGGGTAGGTAGGTAGGTAGG + Intergenic
1119900345 14:78254304-78254326 AGTTGGGTATGGGGGAAGATGGG - Intronic
1120336779 14:83167612-83167634 CAGTGGGAGTGGAGTAAGGTGGG - Intergenic
1121241335 14:92432070-92432092 GGATGGGTACGGAGGATGGTGGG + Intronic
1122737974 14:103854832-103854854 TGGAGGCTATGGAGGGAGGTAGG + Intergenic
1122832108 14:104403507-104403529 AGGTGGGCATGCAGCAAGGTGGG - Intergenic
1124651563 15:31477881-31477903 AGGTGGGTAGGGAGGGAGGGTGG + Exonic
1126344030 15:47674293-47674315 AGGTGAGTGTCGAGGAAGGTTGG + Intronic
1126688488 15:51268249-51268271 GGATGGGTGTGGAGGAAGGATGG - Intronic
1129208899 15:74054126-74054148 GGGTGGGGGTGGAGGAGGGTGGG + Intergenic
1129895858 15:79105334-79105356 TGGTGGGCAGGGAGGCAGGTGGG + Intergenic
1130476056 15:84268699-84268721 CGGTGAGAATGGAGGCAAGTTGG - Intergenic
1130483477 15:84382753-84382775 CGGTGAGAATGGAGGCAAGTTGG - Intergenic
1131015991 15:89058291-89058313 GTGTGGGTGTGGAGGAAGCTTGG - Intergenic
1132242106 15:100265939-100265961 CGGTGGGTGTGGAGCAGGGTGGG - Intronic
1132675087 16:1118198-1118220 CGGTGGGGGTGGCTGAAGGTGGG - Intergenic
1133304007 16:4798828-4798850 AGCTGGGTATGGAGGAGGGCAGG + Intronic
1133413635 16:5589071-5589093 CAGTGGGTATGGAGTGGGGTGGG + Intergenic
1134357037 16:13492048-13492070 AGGTGGGTAGGGACAAAGGTGGG - Intergenic
1135016516 16:18928284-18928306 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1136065762 16:27757290-27757312 TGGTGGGTAGGGCGGGAGGTGGG + Intronic
1136333633 16:29597264-29597286 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1137447246 16:48539381-48539403 GGGTGGGTGTGGAAGAAGGGAGG + Exonic
1137709115 16:50554281-50554303 CAGTGGGGATGTTGGAAGGTGGG + Intronic
1139249606 16:65482145-65482167 AGGTGAGGCTGGAGGAAGGTTGG + Intergenic
1139592379 16:67940479-67940501 CTGTGGATATGGAGCAAGGTGGG + Intronic
1139936142 16:70572532-70572554 CACTGGGTATTGAGGAAGGGTGG + Exonic
1141103663 16:81215802-81215824 AGGTGGGCAGGCAGGAAGGTGGG + Intergenic
1141380599 16:83573193-83573215 GGGGAGGTAGGGAGGAAGGTTGG + Intronic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142932254 17:3296822-3296844 TGGTGGGGATGGCGGAATGTTGG - Intergenic
1146077441 17:29744218-29744240 GGGTGGGGATGCAGGAAGCTGGG + Intronic
1146681350 17:34810627-34810649 TGGTGGCTATGGATGAAGTTTGG - Intergenic
1146683908 17:34827630-34827652 CGGAGGGTCTGGAGGAAGGGGGG - Intergenic
1146937869 17:36823877-36823899 CTGTGGGTACAGGGGAAGGTGGG + Intergenic
1147165023 17:38588524-38588546 GGGTGGGAAGGGAGGAAGGCCGG + Intronic
1147686747 17:42290474-42290496 GAGTGGGTATGGAGGAAGAGAGG + Intronic
1148469583 17:47884926-47884948 CGGTGGGTAGGGAAGGAGCTGGG - Intergenic
1148495882 17:48053364-48053386 GGCTGGGTATGGGGGAAGGGAGG + Intronic
1150371792 17:64645055-64645077 AGGTGGGGAAGGAGGAAGATGGG + Intronic
1151720825 17:75855082-75855104 GGGCGGGGTTGGAGGAAGGTGGG - Intronic
1152425776 17:80217880-80217902 CGGTGGGTATGTTGGCAGGTGGG + Intronic
1154387081 18:13903694-13903716 GGGTGGTTCTGGAGGGAGGTGGG + Intronic
1155162329 18:23206138-23206160 CGGTGGGCAGGGAGGAAGGCAGG - Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1156172803 18:34506421-34506443 CGGTGGGGATGGGAGAAGTTGGG + Intronic
1157663998 18:49470019-49470041 TGGTGGGTATGGAGGAAGGTAGG - Intergenic
1158865995 18:61638226-61638248 GGGAGGGTGTGGTGGAAGGTGGG - Intergenic
1159730892 18:72026202-72026224 GTGTGGGACTGGAGGAAGGTGGG - Intergenic
1160136969 18:76280567-76280589 GGGTGGGTGTGGAGGGACGTGGG - Intergenic
1162547500 19:11339434-11339456 CGGGGGTTTGGGAGGAAGGTAGG - Intronic
1163034105 19:14561641-14561663 AAGTGGGTGGGGAGGAAGGTTGG + Intronic
1166011095 19:39943433-39943455 CGGTGGGTATGGAGGAGGGTAGG + Intergenic
1166334389 19:42096367-42096389 CGGTGCTTGTGGAGGAAGGCGGG - Intronic
1166388672 19:42396794-42396816 CCTTGGGTCTTGAGGAAGGTTGG - Intergenic
1166816901 19:45551744-45551766 CGGGGGCTATGGAGGCAGGAGGG + Intronic
1167510985 19:49895263-49895285 CTGTGGGGATGGAAGAAGGCAGG - Intronic
1167758368 19:51427234-51427256 CTGTGAGAATGGAGGAAGGGAGG + Intergenic
924979345 2:206990-207012 GGGGGGGAAGGGAGGAAGGTAGG + Intergenic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
925976529 2:9145987-9146009 AGGAGGGCATGGCGGAAGGTGGG - Intergenic
926612344 2:14958945-14958967 CAGTGGGAAAGGAGGAAGGGTGG + Intergenic
927705480 2:25294076-25294098 AGCTGGGTGTGGAGGAAGGAAGG - Intronic
931694535 2:64861874-64861896 TGGTGGCTTTGGAGGGAGGTAGG - Intergenic
932449570 2:71800828-71800850 GGGTGGGGCTGGAGGAAGATGGG - Intergenic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
932910391 2:75800206-75800228 TGGTGGGTGGGGAGGAACGTTGG + Intergenic
937038615 2:118803383-118803405 GGGTGGGAATGGAGCAAGGATGG - Intergenic
937793329 2:125986367-125986389 CGGAGGGAATGAAGGAAGGAAGG + Intergenic
938547343 2:132346898-132346920 TGGTAGGTAGGTAGGAAGGTAGG + Intergenic
939008070 2:136811886-136811908 CAATGAGTATGGAGGATGGTGGG - Intronic
941749017 2:169116247-169116269 GGGTGGGAATGGAGGAGTGTGGG - Intergenic
943747789 2:191480164-191480186 CCCTGGGTAGGGAAGAAGGTAGG + Intergenic
947029998 2:225782840-225782862 AGGGAGGTATGGAGGAAGGGAGG - Intergenic
948400147 2:237678384-237678406 CCTGGGGTATGCAGGAAGGTGGG + Intronic
948547970 2:238746073-238746095 CAGTGGGCTTGGAGGATGGTGGG - Intergenic
948929087 2:241119259-241119281 CGGAGGGTGGGGAGGGAGGTGGG + Intronic
948976470 2:241466604-241466626 AGGTGGGGATGCAGGAAGCTGGG - Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169140872 20:3226949-3226971 TGGTGGCGATGGAGGGAGGTGGG - Intergenic
1169221289 20:3824562-3824584 TGGCAGGGATGGAGGAAGGTGGG - Exonic
1171013759 20:21522450-21522472 CGGTGGCGATGGAGGAAGCCCGG - Intergenic
1171017874 20:21557967-21557989 CTGTGGCTGTGCAGGAAGGTGGG + Intergenic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1171876214 20:30579652-30579674 TGGTAGGTAGGTAGGAAGGTAGG + Intergenic
1172397768 20:34621585-34621607 GGGTGAGTATGGAGGCAGGCAGG + Intronic
1172955538 20:38755572-38755594 CGGGGGATGTGAAGGAAGGTGGG - Intronic
1173060085 20:39652206-39652228 CGCTGGCAATGGAGGAAGGAGGG + Intergenic
1173439260 20:43061042-43061064 AGGTGGGTAAGTAGGAGGGTGGG + Intronic
1173939022 20:46894573-46894595 CGGTGGGTGGGGAGGAGGCTGGG + Intergenic
1173969968 20:47145203-47145225 TGATGGGGATGGAGGAGGGTTGG + Intronic
1174103618 20:48146555-48146577 GGGTGGGATTGGAGGAAGGCTGG + Intergenic
1174110536 20:48195006-48195028 CAGTGGGTATGAAGGACGGAGGG - Intergenic
1174295608 20:49543174-49543196 CGGTGGGGATGGGGGAGCGTGGG - Intronic
1174421810 20:50404134-50404156 CGGTGGGCAGAGAGCAAGGTCGG - Intergenic
1174757424 20:53173730-53173752 GGGTGGGTAGGCAGGTAGGTAGG + Intronic
1174919697 20:54688500-54688522 TGCTGGGTATGTAGGAAGCTGGG - Intergenic
1175094466 20:56530361-56530383 AGGTGGGAATGGAGGAAGTTGGG + Intergenic
1175150267 20:56928253-56928275 TGGTGGGGATGGGGGAGGGTGGG + Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175491682 20:59384384-59384406 AGGTGAGTGGGGAGGAAGGTGGG + Intergenic
1175977076 20:62716390-62716412 CGTTGGGACAGGAGGAAGGTCGG + Intronic
1175987296 20:62770454-62770476 GGGTGAATATGGAGGGAGGTGGG + Intergenic
1176061771 20:63175702-63175724 GGGTGGGTAAGGTGGAAGGCTGG - Intergenic
1177449672 21:21249419-21249441 GGTTGGGTAAGGAGCAAGGTGGG - Intronic
1177746797 21:25224998-25225020 AGGTGGGTAGGGGGGAAGCTGGG - Intergenic
1178794030 21:35727001-35727023 CTGTGGGCAAGGAGGAGGGTAGG - Intronic
1179174893 21:39001117-39001139 AGGTGGGGATGGAGGAGGGTGGG - Intergenic
1180085590 21:45506715-45506737 AGGTGGGTGTGTTGGAAGGTGGG - Intronic
1181116598 22:20635659-20635681 CGGTGGGTATGGAGGGGCCTTGG + Intergenic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183978582 22:41526997-41527019 AGGTGTGTGTGGAGGGAGGTTGG - Exonic
1184536111 22:45088111-45088133 AGGTGGCCATGGAGCAAGGTGGG - Intergenic
950337480 3:12208493-12208515 TGGTGTGTATGGTGGGAGGTAGG + Intergenic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
951406550 3:22306741-22306763 AGCTGGGTATGGAGTAAGGGAGG + Intronic
953018747 3:39100649-39100671 TGGTGGAGATGGAGGAGGGTTGG - Intronic
954917970 3:54164685-54164707 CAGTGGGGATGGGGGAAGGATGG + Intronic
955808350 3:62760088-62760110 CCCTGGGCATGGAGGAAGGGAGG - Intronic
955933027 3:64077023-64077045 AAGTGGGAAAGGAGGAAGGTGGG + Intergenic
956289165 3:67643728-67643750 TGGTGGGTTTGTAGGAAGCTTGG - Intronic
956349755 3:68321696-68321718 TGATGGGGATGGATGAAGGTAGG - Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956422290 3:69097777-69097799 TGCTGGGTATTGGGGAAGGTTGG + Intronic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957182775 3:76901901-76901923 AGGTGTGTATGGTGAAAGGTAGG - Intronic
959244107 3:103841337-103841359 CGGTAGGTAGGTAGGTAGGTAGG - Intergenic
961141855 3:124562789-124562811 AGGAGGGCATGGAGGAAGGGGGG - Intronic
961684577 3:128620741-128620763 GGCTGGCTATGGAGGAAGATAGG + Intronic
961747101 3:129071228-129071250 GGGTGAATAAGGAGGAAGGTAGG - Intergenic
962104782 3:132379324-132379346 CTGTGTCTATGGAGGAAGGTGGG + Intergenic
965404535 3:168252845-168252867 TGGTGGGTATGGAGAGAGGTTGG + Intergenic
965607101 3:170508460-170508482 CACTGGGTAGGCAGGAAGGTTGG + Intronic
965766140 3:172132173-172132195 GGTTGAGGATGGAGGAAGGTAGG + Intronic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
966431081 3:179832347-179832369 TGGTGGGTAGGTAGGCAGGTGGG - Intronic
966431106 3:179832451-179832473 AGGTGGGTAGGTAGGTAGGTGGG - Intronic
966431139 3:179832575-179832597 GGGTGGGTAAGTAGGTAGGTTGG - Intronic
966431166 3:179832667-179832689 GGGTGGGTAAGTAGGTAGGTTGG - Intronic
966431203 3:179832836-179832858 TGGTGGGTAGGTAGGTAGGTGGG - Intronic
966794248 3:183698378-183698400 CGGTGGGGATGGCGACAGGTTGG - Intronic
967089310 3:186121762-186121784 AGGTGAGTTTGGAGGAAGTTGGG + Intronic
967093824 3:186160191-186160213 AGGGTGGTATGGAGGAAGGGTGG + Intronic
967823555 3:193860615-193860637 TGGTGAGTATAGAGAAAGGTAGG + Intergenic
967944182 3:194789342-194789364 GGGTGGGAATGAAGAAAGGTTGG - Intergenic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
970224558 4:13844127-13844149 AGATGGGAATGGAGGAAGGGAGG - Intergenic
970522380 4:16898770-16898792 AGGTTGGTATGGAGGAAGGGAGG + Exonic
972459717 4:39289980-39290002 AAGTGAGTATGGAGTAAGGTGGG + Exonic
973276986 4:48320259-48320281 AGGTGGGTGTGGGGTAAGGTTGG + Intergenic
975063344 4:70032724-70032746 CAGTGGGTATGAAAGAATGTAGG + Intronic
975065290 4:70055059-70055081 CAGTGGGTATGAAAGAATGTAGG + Intronic
975299108 4:72768444-72768466 CGGTGAGCATGGAAGAGGGTGGG - Intergenic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976971608 4:91109336-91109358 TGGTGGGTAGGTAGAAAGGTAGG - Intronic
977293927 4:95191782-95191804 AGGTGAGAAGGGAGGAAGGTGGG - Intronic
980115964 4:128679186-128679208 CAGTGGGCATGGTGGAAGGTGGG + Intergenic
980734676 4:136869415-136869437 AGGTGGGAAGGGAGGAAGGGAGG + Intergenic
981808083 4:148740315-148740337 GGCTGGGTAAGGAGGCAGGTGGG + Intergenic
982326101 4:154129392-154129414 TGGGGGGTATAGAGGAAGATGGG + Intergenic
984702713 4:182828424-182828446 CGGGAGGAAGGGAGGAAGGTAGG - Intergenic
984814669 4:183825336-183825358 CAGTAGGTTGGGAGGAAGGTGGG + Intergenic
985746523 5:1651689-1651711 AGGTGGGGCTGGAAGAAGGTAGG + Intergenic
987735597 5:21838868-21838890 ATGTGGGTATGGATGAAGGCTGG - Intronic
990088613 5:52011556-52011578 TTGTGGGTCTGGATGAAGGTTGG - Exonic
990783474 5:59393531-59393553 AGGTGTGAATGGAGAAAGGTAGG - Intronic
993099853 5:83524511-83524533 AGGTAGGTAGGTAGGAAGGTAGG - Intronic
993845383 5:92935984-92936006 TCCTGGGTATGGAGGGAGGTAGG + Intergenic
995554493 5:113313495-113313517 CGGTGGTTGGGGAGGAAGGAGGG + Intronic
997590066 5:135066986-135067008 TGGTGGGAATGGAGGAAGCCAGG + Intronic
997785475 5:136708138-136708160 AGGAGGGTATGGAGAAATGTCGG + Intergenic
999264257 5:150256274-150256296 CGGTGGGTGGGGAAGAAGGCAGG - Intronic
1002417422 5:179127780-179127802 CGGTGGGTGGGCAGGAAGGGGGG - Intronic
1002466604 5:179411880-179411902 TGGTGGGGAGGGTGGAAGGTCGG - Intergenic
1002466856 5:179412457-179412479 GGGGGGGGAGGGAGGAAGGTCGG - Intergenic
1003249513 6:4413686-4413708 AGGTGGGCCTGGAGGAAGGTGGG - Intergenic
1003288134 6:4752874-4752896 AGGTAGGTATGTAGGTAGGTAGG + Intronic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860690 6:10319449-10319471 CGGTGGGGATGGCGGGACGTGGG + Intergenic
1003860757 6:10319690-10319712 CCATGGGGATGGAGGAACGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1004748204 6:18534000-18534022 GGGTGGGGTTGTAGGAAGGTGGG + Intergenic
1006582766 6:35086319-35086341 CGGTAGGTAGGAAGGACGGTGGG - Intronic
1006668753 6:35716673-35716695 AGTTGGGTAGGGAGGAAGCTTGG - Intronic
1006902629 6:37512920-37512942 AGCTGGGTTTGGAGGAAGGGAGG + Intergenic
1007745689 6:44041714-44041736 CGCTGGGGGTGGAGGGAGGTGGG - Intergenic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1007960347 6:45953348-45953370 GGGTGAGTCTGGAGGGAGGTTGG + Intronic
1009303132 6:62052603-62052625 GGGTGGGGGTGGAGGAGGGTGGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1016460014 6:144272162-144272184 GGGTGGGTATGGGGAGAGGTAGG + Intergenic
1016526676 6:145009681-145009703 AGTTGGGTAGGGAGGAAGGGAGG + Intergenic
1017698167 6:157039756-157039778 AGGTAGGTAGGTAGGAAGGTAGG - Intronic
1017739461 6:157394151-157394173 CGGTGGGTAGGCGGGAAGGGTGG - Intronic
1018476061 6:164142934-164142956 GGGAGGGTCTGGAGGAAGGAAGG + Intergenic
1018621734 6:165735364-165735386 GGGTGGGTAGGTAGGTAGGTAGG + Intronic
1019059011 6:169242587-169242609 AGGTGGGAATGTGGGAAGGTGGG - Intronic
1019059057 6:169242720-169242742 CGGTGGGAAGGTGGGAAGGTGGG - Intronic
1019059150 6:169243000-169243022 AGGTGGGAATGTGGGAAGGTGGG - Intronic
1019059155 6:169243016-169243038 CGGTGGGAAGGTGGGAAGGTGGG - Intronic
1019059190 6:169243116-169243138 CGGTGGGAAGGTGGGAAGGTAGG - Intronic
1019059201 6:169243149-169243171 AGGTGGGAATGTGGGAAGGTGGG - Intronic
1019261803 7:86100-86122 GGGTGGGTGTGGGGGAAGCTGGG + Intergenic
1020865114 7:13550366-13550388 AGGTGGGTAGGGAAGAAGGTGGG + Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021491802 7:21227145-21227167 GGGTGGGTAGGTAGGTAGGTAGG - Intergenic
1022515871 7:30974690-30974712 CTGTGGGGCTGGGGGAAGGTGGG + Intronic
1023061466 7:36331392-36331414 CGGTGGGAGTAGGGGAAGGTGGG - Intronic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1025942200 7:66082773-66082795 CCTGGGGTATGGAGGTAGGTTGG + Intronic
1027426340 7:78065041-78065063 CACTGAGTATGGAGGAAGGAAGG + Intronic
1028531264 7:91841275-91841297 TGCTGGGGATGGAGGGAGGTGGG - Intronic
1029103784 7:98157251-98157273 CGGTAGGTAGGTAGGTAGGTAGG + Intronic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029743291 7:102503246-102503268 TGGTGGGGGTGGAGGAAGATTGG + Intronic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029761280 7:102602407-102602429 TGGTGGGGGTGGAGGAAGATTGG + Intronic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1031151699 7:118061375-118061397 TGGTGGGTGTGGATGAAGTTGGG + Intergenic
1032447733 7:131999136-131999158 CCGAGGCTATGGAGGAAGGAGGG - Intergenic
1032691606 7:134293446-134293468 CGATGGGTATTGAGGATGGTTGG - Exonic
1032757082 7:134901422-134901444 GGGTGGGAATGGGGGAACGTAGG + Intronic
1032851448 7:135799005-135799027 TGGTTGGTATGGAGGCAGGGTGG - Intergenic
1033158010 7:138972661-138972683 CGGAGGGACTGGTGGAAGGTTGG - Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1033558752 7:142511181-142511203 CTGGGGGAATGGAGGAAGCTGGG + Intergenic
1033704648 7:143875135-143875157 TGATGGGAATGGAGCAAGGTAGG - Intronic
1034937563 7:155209852-155209874 GGGTGGGAATGGAGCAGGGTAGG - Intergenic
1035287068 7:157813363-157813385 CGGTGGGGAGGGAAGAGGGTGGG + Intronic
1035911177 8:3567727-3567749 CAGAGGATGTGGAGGAAGGTTGG - Intronic
1036206061 8:6806383-6806405 GGGTGGGGATGGAGGGTGGTTGG + Intergenic
1037675065 8:21044099-21044121 AGGTGGGCTTGGAGGATGGTGGG - Intergenic
1037802627 8:22043756-22043778 AGGTGTGCATGGAGGGAGGTGGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038240556 8:25804229-25804251 GGGTGGGTAGGTAGGTAGGTAGG - Intergenic
1039592003 8:38757232-38757254 CGGTGGGGCGGGAGGAAGGGTGG - Intronic
1042210422 8:66375177-66375199 GGGTGGGAATTGAGGAAGGAGGG - Intergenic
1042487984 8:69367513-69367535 TGGTGGGAAGGGAGGAAAGTAGG - Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1043925450 8:86031270-86031292 CCCTGAGTATGGAGGAAGATGGG + Intronic
1044697172 8:94935089-94935111 CGGTAGGTAGGTAGGTAGGTAGG + Intronic
1044768508 8:95603849-95603871 GGATGGGGAGGGAGGAAGGTAGG - Intergenic
1046848227 8:118942916-118942938 AGGTAGGTAGGTAGGAAGGTAGG - Intronic
1047741845 8:127812663-127812685 GGGAGGGAAGGGAGGAAGGTAGG + Intergenic
1049199226 8:141331727-141331749 CGGGGTGTGTGGAGGAAGGAAGG + Intergenic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1050316620 9:4408390-4408412 GGGGCGGTAGGGAGGAAGGTGGG + Intergenic
1051000436 9:12275370-12275392 AGGTGGGAAAGGAGGAAGGGAGG + Intergenic
1051125866 9:13805088-13805110 AGGAGGGTATGGAGGCAGGGAGG - Intergenic
1051679437 9:19592477-19592499 AGGTGGGTAGGTAGGTAGGTAGG - Intronic
1052922358 9:33981761-33981783 AGGTAGGTAGGTAGGAAGGTAGG + Intronic
1056286503 9:85092574-85092596 AGGTAGGTATGGAGTAAGGTGGG + Intergenic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1057865358 9:98675809-98675831 AGGGTGGTATGGAGGAAGGCAGG + Intronic
1058777598 9:108300354-108300376 CGGTGGGCATGGAGGCATGATGG - Intergenic
1060405068 9:123368941-123368963 TGGCAGGTATGGAGGAATGTGGG + Intronic
1060725338 9:126002508-126002530 TGGTGTGTATGGAGGAAGGGTGG + Intergenic
1061396467 9:130346463-130346485 CGGTGGGGCTGGAGGCAGGGGGG + Intronic
1185766924 X:2732997-2733019 AGGGAGGTATGGAGGAAGGGAGG - Intronic
1185933574 X:4230411-4230433 AGGTGGGTAAGTAGGTAGGTAGG - Intergenic
1186559482 X:10595658-10595680 CTGAGGGTATGGGGGAAGGGAGG + Intronic
1186657351 X:11629133-11629155 TGGTGGAGATGGAGGAAAGTAGG - Intronic
1187258618 X:17664361-17664383 GGTTGTGTATGGAGTAAGGTAGG + Intronic
1187354082 X:18550333-18550355 CTGTGGGTATGGATGTGGGTGGG - Intronic
1188052058 X:25499756-25499778 AGGTAGGTAAGGAGGTAGGTAGG - Intergenic
1189988361 X:46573580-46573602 CGGAGGGTTTGGGGAAAGGTGGG + Intergenic
1190064071 X:47228679-47228701 TGGTGGGTAAGCAGGTAGGTGGG - Intronic
1190303196 X:49067978-49068000 CAGCGGGCATGGAGGAAGGGTGG - Exonic
1192591452 X:72363321-72363343 GGGTGGGGATGGAAGAAGGAAGG + Intronic
1195234915 X:102887808-102887830 AGGTGGGAAGGGAAGAAGGTGGG - Intergenic
1195252568 X:103063494-103063516 TGGTGGGTTTGGGGGCAGGTAGG - Intronic
1195273402 X:103254803-103254825 CGGTGGGCACGGAGGAGGGCGGG - Intronic
1195285335 X:103377260-103377282 TGGTGGGTTTGGGGGAAGGGAGG + Intronic
1197564623 X:128066930-128066952 GGGTGGGAGTGGGGGAAGGTGGG + Intergenic
1199086308 X:143634059-143634081 CGGTGGGTGAGGAGGAAGAGAGG + Intronic
1199673257 X:150163984-150164006 TGGTGGGCATGGAGGCAGATTGG + Intergenic
1199825827 X:151498386-151498408 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199871716 X:151904384-151904406 TGGTGGGGAGGGAGGAAGGAGGG - Intergenic
1199896000 X:152128252-152128274 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1200015957 X:153164082-153164104 GTGTGGGAAGGGAGGAAGGTGGG - Intergenic
1200094603 X:153651357-153651379 TGGAGGGTTTGGGGGAAGGTGGG + Intergenic
1201438409 Y:13984885-13984907 CTGTGGGGAGGGAGGAAGGGGGG - Intergenic
1201438446 Y:13985005-13985027 CTGTGGGGAGGGAGGAAGGGTGG - Intergenic
1201446127 Y:14057703-14057725 CTGTGGGGAGGGAGGAAGGGTGG + Intergenic
1201446164 Y:14057823-14057845 CTGTGGGGAGGGAGGAAGGGGGG + Intergenic