ID: 1089278138

View in Genome Browser
Species Human (GRCh38)
Location 11:117353483-117353505
Sequence GCTTGACGAAAGGCAGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089278129_1089278138 22 Left 1089278129 11:117353438-117353460 CCCAGGATTATTTGAAGTGGTAG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1089278138 11:117353483-117353505 GCTTGACGAAAGGCAGGAGACGG 0: 1
1: 0
2: 1
3: 11
4: 176
1089278130_1089278138 21 Left 1089278130 11:117353439-117353461 CCAGGATTATTTGAAGTGGTAGT 0: 1
1: 0
2: 2
3: 12
4: 96
Right 1089278138 11:117353483-117353505 GCTTGACGAAAGGCAGGAGACGG 0: 1
1: 0
2: 1
3: 11
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089278138 Original CRISPR GCTTGACGAAAGGCAGGAGA CGG Intronic
900343135 1:2198006-2198028 ACTTGAGGACAGGCAGGACAAGG - Intronic
901643528 1:10704926-10704948 GCCTGAGGAAAGGCAGGACATGG + Intronic
904702448 1:32365987-32366009 GCTGGAGGAAAGGAAGGAGGTGG + Intronic
907217462 1:52877226-52877248 GCTTTAGGAAGGGTAGGAGAGGG - Intronic
907298521 1:53470779-53470801 CCTTGACGGAAGGCAGCAGCGGG - Intergenic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
910632368 1:89369217-89369239 GGTTGAAGAAAGACACGAGAAGG - Intronic
913407993 1:118517355-118517377 GCTGAACAAAAGGCAGCAGACGG - Intergenic
914764433 1:150625606-150625628 GGTTGAGGAAGGGGAGGAGAGGG + Intronic
914833510 1:151188681-151188703 GCTTGATGAAAAGCAGGAGAAGG - Intronic
914903715 1:151727163-151727185 GCTAGTCGAGAGGCTGGAGATGG + Intronic
917171062 1:172175104-172175126 GCCTGGCTAAAGTCAGGAGAGGG - Intronic
918557299 1:185817992-185818014 GCTTAGCCAAATGCAGGAGATGG - Intronic
918641662 1:186848382-186848404 GTTTGACCATAGGCAGGGGAGGG + Intronic
920068053 1:203283001-203283023 GCATGAGGGAAGGCAGCAGATGG - Intergenic
921147993 1:212377706-212377728 GCTTGGAGGAAGGAAGGAGAAGG + Exonic
923688888 1:236174327-236174349 GCTTGCAGAAAGACAGGAGGTGG + Intronic
1064329353 10:14379302-14379324 GCTTGTGGGAAGGGAGGAGATGG - Intronic
1066161610 10:32738319-32738341 GAGTGACAAAAGGCAGGAAATGG - Intronic
1066535723 10:36389356-36389378 GCTTCACTAAAGGCAGCAGCAGG - Intergenic
1067037705 10:42932250-42932272 CCTTGAAGTAAGGCAGGACAAGG + Intergenic
1067287897 10:44920900-44920922 GGTTGACGAAAGCTAGGAGGGGG - Intronic
1067516297 10:46948711-46948733 GCTGGAAGATAGGCAGGAGAAGG - Intronic
1067645952 10:48103082-48103104 GCTGGAAGACAGGCAGGAGAAGG + Intergenic
1069984098 10:72272375-72272397 GCTTGAAGAATGGGAAGAGAAGG + Intergenic
1070321086 10:75355143-75355165 GCTTCACGAATAGCAGCAGATGG - Intergenic
1072894196 10:99351622-99351644 GCTTTATCACAGGCAGGAGAGGG - Intronic
1072912931 10:99520060-99520082 GCTTGGCCAAAGCCAGAAGATGG - Intergenic
1075478348 10:122756246-122756268 GCTTGAGAGAAGGAAGGAGAAGG + Intergenic
1081862378 11:46340614-46340636 GCTTCACGAAAGTCATGAGCAGG - Intronic
1084334276 11:68447600-68447622 GCATGAGCAAAGGCAGGAGGTGG - Intronic
1085199686 11:74694324-74694346 TCTGGACCAAAGTCAGGAGAGGG + Intergenic
1085301558 11:75461923-75461945 GCTTAGCAAAAGGCAGGCGATGG + Intronic
1089278138 11:117353483-117353505 GCTTGACGAAAGGCAGGAGACGG + Intronic
1090582777 11:128178268-128178290 GCCTGACGAGAGGGAGGAGGTGG - Intergenic
1098232795 12:68390065-68390087 GCTAGCACAAAGGCAGGAGAGGG + Intergenic
1099932058 12:89086268-89086290 GCTTGAGGAAAGGAAGGATTTGG + Intergenic
1106160334 13:27195633-27195655 GCTTGTCAAAATACAGGAGATGG + Intergenic
1109802782 13:67400435-67400457 GCTTGGGGGAAGGCAGGAAAGGG - Intergenic
1110441828 13:75535020-75535042 GCGTGACGAAATGCAGGGTAAGG + Intronic
1110506343 13:76292059-76292081 GCCTAAGCAAAGGCAGGAGATGG + Intergenic
1112541240 13:100315448-100315470 GCTTTATGAAAGGCAGAAAAGGG + Intronic
1114729388 14:24975388-24975410 GCGTGATCAAAGGCAGAAGAAGG - Intronic
1116658497 14:47678385-47678407 GCTTAAGGACAGGCAAGAGATGG + Intergenic
1117352388 14:54893842-54893864 ACTTGACCAATGCCAGGAGATGG - Intronic
1120299872 14:82692671-82692693 GGTTGAGGAAGGGGAGGAGAGGG + Intergenic
1121087079 14:91154918-91154940 GCCTGACACAAGGCAGGAGGTGG - Intronic
1121461415 14:94081372-94081394 GCTTGGGAAAAGGCCGGAGAAGG + Exonic
1122311541 14:100799076-100799098 GCTTGAGCCCAGGCAGGAGACGG + Intergenic
1125609355 15:40960316-40960338 CCTGGAGGAAAGGCAGGAGCTGG + Intergenic
1129028791 15:72604211-72604233 GCAGGAGGAAAGGAAGGAGAGGG + Intergenic
1129237842 15:74234415-74234437 GCTGGAGGAAGGGGAGGAGAAGG + Intergenic
1130673101 15:85930456-85930478 GGTAGACAGAAGGCAGGAGAAGG - Intergenic
1130673141 15:85930624-85930646 GGTAGACAGAAGGCAGGAGAGGG - Intergenic
1133001160 16:2852439-2852461 GCTTCAGGAAGGGGAGGAGAGGG - Intergenic
1133072524 16:3256059-3256081 GGGTCACGAAAGGCAGGAGCTGG - Intronic
1134286204 16:12864164-12864186 GCTTGACAAAGAGCAGGAGGAGG + Intergenic
1134596876 16:15502750-15502772 TCTTGACAAAAGGCTGGAGGGGG + Intronic
1135556010 16:23437140-23437162 GCTTGACTCTAGGCAGGACATGG - Intronic
1135811073 16:25587322-25587344 GCTTTCAGAAAGGCAGAAGATGG - Intergenic
1138197056 16:55059561-55059583 GCTTGGGGAAAGACAGGAGGTGG + Intergenic
1138572367 16:57884172-57884194 GCCGGAGGAAAGGGAGGAGAAGG - Exonic
1139261164 16:65595650-65595672 GCTTGAAGTAGGGCAGAAGAAGG + Intergenic
1145230488 17:21170093-21170115 AATTGACAAAAGGCAAGAGAAGG - Intronic
1149658783 17:58324015-58324037 GCTTGGGGGAAGCCAGGAGAAGG - Intronic
1149829425 17:59858526-59858548 GCTTAACGAAATGCAGCAGCGGG + Intergenic
1151523473 17:74647761-74647783 ACTTGACCAAGGGAAGGAGATGG - Intergenic
1151730719 17:75909646-75909668 GCTGGACCACAGCCAGGAGAAGG - Exonic
1153230283 18:2928555-2928577 GCTTTCGGAAAGGCAGCAGATGG + Intronic
1154005600 18:10525033-10525055 GCTTGGAGAAAGGAGGGAGAGGG + Intergenic
1154069079 18:11136641-11136663 GTTTGATGAGAGGAAGGAGAGGG + Intronic
1155021148 18:21898045-21898067 GCTTGAGTAAAGCCAGGTGATGG - Intergenic
1157121728 18:44917692-44917714 GCTTGAGGACAAGCTGGAGAGGG - Intronic
1157294321 18:46431664-46431686 GGTTGACCCGAGGCAGGAGAGGG - Intronic
1158962357 18:62597161-62597183 GCATGCAGAAAGGGAGGAGAAGG - Intergenic
1161390064 19:4016115-4016137 CCTTGCCGACAGGCAGGACAGGG - Intronic
1161674328 19:5635719-5635741 GCTTAACAGAAGGCAAGAGATGG + Intronic
1161719148 19:5893790-5893812 GCTTGAGAAAAGGGAAGAGATGG + Intronic
1165259309 19:34598666-34598688 GCTGGAAGCAAGGCAGGAAATGG - Intronic
1165285582 19:34839073-34839095 GCTCGAAGAAACGCAGCAGAGGG + Intergenic
1165326199 19:35115808-35115830 GCGTGACCAAAGTCAGGAGATGG - Intergenic
1167339318 19:48905534-48905556 GCTTGATGAATGACAGGAGATGG + Intronic
1168377299 19:55891146-55891168 GGGTGAAGAAGGGCAGGAGATGG + Intergenic
926547560 2:14260636-14260658 GCTTGAGGAAAGGGATGAGGGGG + Intergenic
927127653 2:20027374-20027396 GCTGGAGGAAGGGCTGGAGAGGG - Intergenic
927482708 2:23467089-23467111 GGGTCACCAAAGGCAGGAGAAGG - Intronic
928822292 2:35375913-35375935 GTTTGACCAAAGGAAGGAAAAGG + Intergenic
929666559 2:43838457-43838479 GAGTGAAGAAAGGCAGCAGAGGG + Intronic
930621891 2:53652518-53652540 GCTTCAGGAAAGAAAGGAGATGG + Intronic
931736070 2:65195774-65195796 GCATGGCGTAAGGGAGGAGAGGG + Intergenic
931842231 2:66165551-66165573 GCTTGACAAAAGACAGGAGGGGG + Intergenic
932332525 2:70905784-70905806 GCTACAGGAAAGGGAGGAGATGG + Intronic
933779744 2:85793150-85793172 GCTTGTCCAAAGGCAGCAGATGG + Intergenic
934851567 2:97705234-97705256 GCCTCAGGAAAGGCAGGGGAAGG + Intergenic
935253607 2:101288151-101288173 GCTTGAAGGAAGGCAGGGCATGG - Intronic
937118920 2:119428801-119428823 GCTTAAAGAAAGGCAGGAAGTGG - Intergenic
942665338 2:178311256-178311278 GCTAGATGAAAAGCAGGTGAGGG - Intronic
943004552 2:182373747-182373769 GCTTGTTTAAAGGCAGAAGAAGG + Intronic
945186562 2:207145865-207145887 GAATGAGGAAAGGAAGGAGAAGG + Intronic
948109808 2:235445390-235445412 GATTGACGAAAGCCAAGTGAGGG - Intergenic
948806621 2:240455961-240455983 GCTGGACGCAAGGCGGGCGAAGG - Intronic
1173190491 20:40872101-40872123 GCTTGAGCAAAGACAAGAGAGGG + Intergenic
1174860424 20:54086271-54086293 GCTGGAGGACATGCAGGAGAAGG - Intergenic
1174993953 20:55544696-55544718 GCTTGTGAAAAGGCAGGCGAAGG - Intergenic
1175168019 20:57059867-57059889 GCATGAGGAGAGGGAGGAGATGG + Intergenic
1175234801 20:57502465-57502487 TCTTGAGGAAAGGCAGGTGGAGG + Intronic
1175279331 20:57792876-57792898 GCTTGAAGAATTGCAGGAGCAGG - Intergenic
1175671260 20:60904640-60904662 GCTTGACCTGAGGCTGGAGAGGG - Intergenic
1175781647 20:61685957-61685979 CTCTGATGAAAGGCAGGAGAGGG - Intronic
1177918010 21:27114894-27114916 ACGTGAAGAAAGGGAGGAGAGGG - Intergenic
1178890231 21:36514798-36514820 GCTGGAGGCAAGGCAAGAGAAGG - Intronic
1183226295 22:36552284-36552306 CCTTGAGAAAAGGCAGGAAAGGG - Intergenic
950093193 3:10311936-10311958 ACTGCACGAAAGGCAGGGGATGG + Intronic
953329771 3:42043292-42043314 GCTGGACAAAAAGGAGGAGACGG - Intronic
954688977 3:52385862-52385884 GCTAGAAGAAAGGCAGGAGGAGG + Intronic
954720096 3:52554244-52554266 GCTTGAGGAGAAGTAGGAGATGG + Intronic
960939264 3:122922787-122922809 GCTTGGCCCAAGGTAGGAGAGGG - Intronic
962317962 3:134370653-134370675 GCTGGAAGAAAGCCAGGAGTTGG + Intronic
962708147 3:138064354-138064376 GCTCTCCGAGAGGCAGGAGATGG + Intronic
963062117 3:141233558-141233580 ACTTAATGAAAGCCAGGAGAAGG - Intronic
964976355 3:162624682-162624704 GCTTAACCAAAGGTGGGAGATGG + Intergenic
968173233 3:196527275-196527297 GTTTGACTGAAGGCAGGAGAAGG - Intergenic
972353677 4:38260516-38260538 GCTTGAGCAAAGGCAGGGGTGGG + Intergenic
972469172 4:39387296-39387318 GTTTGAGGAGAGGCAGGACATGG + Intergenic
972692251 4:41410770-41410792 GCTTGAGGAAAGCCAGAAGATGG - Intronic
976389882 4:84497129-84497151 GCTGGACGACAGGGAGGAGCCGG + Intronic
980321392 4:131282880-131282902 ACTTGGCCAAAGGCAGAAGAGGG - Intergenic
980874223 4:138644795-138644817 GCTTGACTAAGGGCATGAGTTGG + Intergenic
982159351 4:152552330-152552352 GCCTCACGAAAGGCAGCAAAAGG - Intergenic
983873933 4:172854150-172854172 GCTTGAAGAAAGGTAGGACAAGG - Intronic
984710147 4:182878037-182878059 GCTTGGTGAAAGTCAGCAGAAGG - Intergenic
985774848 5:1835666-1835688 GTGTGACCAAAGGCAGGACACGG - Intergenic
994124427 5:96153466-96153488 GCTTGACGAGAGGAATGAAAAGG + Intergenic
995354843 5:111225065-111225087 GCTTGACGAGGGGAAGGAGGAGG - Intronic
997806697 5:136924758-136924780 TCATGAACAAAGGCAGGAGAAGG + Intergenic
998533073 5:142903042-142903064 GCTAGAGGAAAGGCAGAAGGGGG - Intronic
1001100012 5:168806529-168806551 GCAGGGCGAAGGGCAGGAGATGG + Exonic
1001343592 5:170869538-170869560 GCTGGGCGAAAGGCATGAAATGG - Intronic
1002806104 6:575528-575550 GCATGTCGCATGGCAGGAGATGG - Intronic
1004154818 6:13158244-13158266 GCTTGGGGAAGGGCTGGAGAAGG - Intronic
1005209160 6:23440823-23440845 GAAAGAAGAAAGGCAGGAGAGGG - Intergenic
1005808989 6:29502137-29502159 GCATGACCAAAGGGAGGAGGGGG + Intergenic
1006443071 6:34063916-34063938 GCGGGAAGGAAGGCAGGAGAAGG + Intronic
1006733310 6:36252878-36252900 GTTGGACGAAAGGCAATAGAGGG + Intronic
1007418889 6:41707532-41707554 GCTAGGGGAAGGGCAGGAGATGG - Intronic
1008567392 6:52782859-52782881 GCTTGACTGAAGGCAGTGGAAGG - Intergenic
1010618181 6:78040652-78040674 GCATGTCAAACGGCAGGAGAGGG + Intergenic
1013821144 6:114154690-114154712 GCTTGGGGGAAGGCAGGAGGAGG + Intronic
1015963753 6:138676954-138676976 GTTTGATAAAAGGCAGCAGATGG - Intronic
1017344807 6:153368559-153368581 GCCTGGAGCAAGGCAGGAGAGGG - Intergenic
1018028802 6:159826109-159826131 GGTGGACGAGAGGCAGGAGCCGG + Intergenic
1019534272 7:1520415-1520437 TCATGACCAAGGGCAGGAGAAGG - Intergenic
1021239831 7:18186588-18186610 GCTTGAGGAATGTCAGGAGTGGG + Intronic
1021777835 7:24071229-24071251 AGTTGAGGAAAGGGAGGAGAGGG - Intergenic
1023706054 7:42942810-42942832 GGTTGTAGAAATGCAGGAGAGGG + Intronic
1025694196 7:63766443-63766465 GGCTGACGAGAGGCAGGAGCTGG - Intergenic
1026315644 7:69224904-69224926 GCATGAAGAAAGGGAGGGGAAGG - Intergenic
1032362723 7:131271291-131271313 CGTTGAGGAAAGGCATGAGATGG + Intronic
1033411251 7:141119700-141119722 GATGGAGGAAAGGCTGGAGAAGG + Intronic
1036182712 8:6598679-6598701 GCTTCACGACAGGCGTGAGAAGG + Intronic
1036631496 8:10519019-10519041 GCTGGAGGAAACCCAGGAGAGGG + Intergenic
1038328332 8:26589002-26589024 GCCTGGCGAGAGGCAGGAGGTGG - Intronic
1039881512 8:41628133-41628155 GGTTGGCTAAAGGCAGGACAAGG + Intergenic
1040466714 8:47702379-47702401 GGTTGAAGAAAGGAAAGAGATGG + Intronic
1042810112 8:72815793-72815815 CCTTGAGGAAGGTCAGGAGAGGG + Intronic
1043366801 8:79542625-79542647 GCTTGAGGAGAGGGAAGAGAGGG + Intergenic
1043709682 8:83400579-83400601 GACTGACCAAAGGCAGCAGAGGG + Intergenic
1049398552 8:142413148-142413170 GGAGGAGGAAAGGCAGGAGATGG - Intergenic
1052871420 9:33511077-33511099 GCGTGAGGAAAGGGGGGAGAGGG + Intergenic
1053000604 9:34575372-34575394 ACTCAACGAAAGGCAGGGGATGG + Intronic
1057305671 9:93910747-93910769 GCTTGGCGAAAGCCTGGAGTTGG - Intergenic
1057868201 9:98698200-98698222 CCTTGCCAAATGGCAGGAGAAGG + Intronic
1060201317 9:121653080-121653102 ACTTCAGGAAAGGCAGGAGTGGG - Intronic
1060890843 9:127187214-127187236 CCTTGAGGAAAGGAAGGTGATGG - Intronic
1060926968 9:127461814-127461836 GCTTAAGGACAGCCAGGAGAAGG - Intronic
1061065856 9:128276910-128276932 GCATGAGGAAAGGAAGGGGAGGG - Intronic
1061322480 9:129839860-129839882 GCCTGAGGAAGGGCAGGGGAGGG - Intronic
1061424953 9:130493011-130493033 GCCGGAAGACAGGCAGGAGATGG - Intronic
1061443889 9:130626548-130626570 GCTTGAGGGAAGGCAGGTCACGG + Intronic
1186143535 X:6602369-6602391 GGTGGAAGGAAGGCAGGAGAAGG - Intergenic
1188605806 X:32028014-32028036 GCAAGAAGAGAGGCAGGAGAGGG + Intronic
1189348715 X:40261636-40261658 GCATGACGAAAAGCAGAGGAAGG - Intergenic
1191679790 X:63829379-63829401 GATTGAGGAGAGGCAGCAGAAGG - Intergenic
1191780067 X:64855343-64855365 GCTTGAGGAATGGCAGGGAAAGG - Intergenic
1195063081 X:101215421-101215443 GCTTGAAGAACAGCAGAAGAGGG + Intergenic
1195112876 X:101665188-101665210 GCTTCATGAAAGGCAGCAAAAGG - Intergenic
1196255724 X:113515933-113515955 GCTTCAAGAAAGGCAGAATAGGG + Intergenic
1198036109 X:132802999-132803021 GCTTGATGACAGCCATGAGAAGG + Intronic
1200117876 X:153777091-153777113 ACTGGAAGAAAGGAAGGAGATGG - Intronic