ID: 1089279505

View in Genome Browser
Species Human (GRCh38)
Location 11:117363434-117363456
Sequence TAAGAGGCTCACTTGAGCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9839
Summary {0: 1, 1: 2, 2: 43, 3: 965, 4: 8828}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089279505_1089279519 28 Left 1089279505 11:117363434-117363456 CCACAGCTCAAGTGAGCCTCTTA 0: 1
1: 2
2: 43
3: 965
4: 8828
Right 1089279519 11:117363485-117363507 GGGGGGTGACTTTGAGTATGAGG 0: 1
1: 0
2: 1
3: 17
4: 178
1089279505_1089279507 -8 Left 1089279505 11:117363434-117363456 CCACAGCTCAAGTGAGCCTCTTA 0: 1
1: 2
2: 43
3: 965
4: 8828
Right 1089279507 11:117363449-117363471 GCCTCTTAGGAACCTACACCTGG 0: 1
1: 0
2: 0
3: 7
4: 81
1089279505_1089279510 0 Left 1089279505 11:117363434-117363456 CCACAGCTCAAGTGAGCCTCTTA 0: 1
1: 2
2: 43
3: 965
4: 8828
Right 1089279510 11:117363457-117363479 GGAACCTACACCTGGACATTGGG 0: 1
1: 1
2: 0
3: 35
4: 969
1089279505_1089279511 1 Left 1089279505 11:117363434-117363456 CCACAGCTCAAGTGAGCCTCTTA 0: 1
1: 2
2: 43
3: 965
4: 8828
Right 1089279511 11:117363458-117363480 GAACCTACACCTGGACATTGGGG 0: 1
1: 0
2: 1
3: 12
4: 99
1089279505_1089279509 -1 Left 1089279505 11:117363434-117363456 CCACAGCTCAAGTGAGCCTCTTA 0: 1
1: 2
2: 43
3: 965
4: 8828
Right 1089279509 11:117363456-117363478 AGGAACCTACACCTGGACATTGG 0: 1
1: 0
2: 1
3: 10
4: 107
1089279505_1089279518 11 Left 1089279505 11:117363434-117363456 CCACAGCTCAAGTGAGCCTCTTA 0: 1
1: 2
2: 43
3: 965
4: 8828
Right 1089279518 11:117363468-117363490 CTGGACATTGGGGCACTGGGGGG 0: 1
1: 0
2: 1
3: 28
4: 257
1089279505_1089279513 7 Left 1089279505 11:117363434-117363456 CCACAGCTCAAGTGAGCCTCTTA 0: 1
1: 2
2: 43
3: 965
4: 8828
Right 1089279513 11:117363464-117363486 ACACCTGGACATTGGGGCACTGG 0: 1
1: 0
2: 0
3: 7
4: 153
1089279505_1089279515 9 Left 1089279505 11:117363434-117363456 CCACAGCTCAAGTGAGCCTCTTA 0: 1
1: 2
2: 43
3: 965
4: 8828
Right 1089279515 11:117363466-117363488 ACCTGGACATTGGGGCACTGGGG 0: 1
1: 0
2: 1
3: 9
4: 194
1089279505_1089279514 8 Left 1089279505 11:117363434-117363456 CCACAGCTCAAGTGAGCCTCTTA 0: 1
1: 2
2: 43
3: 965
4: 8828
Right 1089279514 11:117363465-117363487 CACCTGGACATTGGGGCACTGGG 0: 1
1: 0
2: 0
3: 7
4: 148
1089279505_1089279517 10 Left 1089279505 11:117363434-117363456 CCACAGCTCAAGTGAGCCTCTTA 0: 1
1: 2
2: 43
3: 965
4: 8828
Right 1089279517 11:117363467-117363489 CCTGGACATTGGGGCACTGGGGG 0: 1
1: 0
2: 2
3: 28
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089279505 Original CRISPR TAAGAGGCTCACTTGAGCTG TGG (reversed) Exonic
Too many off-targets to display for this crispr