ID: 1089279958

View in Genome Browser
Species Human (GRCh38)
Location 11:117366996-117367018
Sequence CTGTGAAAGGAGGAGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 829
Summary {0: 1, 1: 0, 2: 8, 3: 110, 4: 710}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089279951_1089279958 2 Left 1089279951 11:117366971-117366993 CCTTGAGATGCTCAAGGACCTGG 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1089279958 11:117366996-117367018 CTGTGAAAGGAGGAGACAGAAGG 0: 1
1: 0
2: 8
3: 110
4: 710

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089279958 Original CRISPR CTGTGAAAGGAGGAGACAGA AGG Intronic
900481332 1:2900883-2900905 CTGTGCAGGAAGGAGGCAGACGG - Intergenic
900972429 1:5998949-5998971 CCGTGAAAGGAGGAAAAGGAAGG + Intronic
901090860 1:6640181-6640203 CTGTGAAAGGAGCAGACTGCAGG - Intronic
901174095 1:7285938-7285960 CTGTGAAAAGAGGACACATGTGG - Intronic
901356563 1:8654878-8654900 CTTTGGGAGGCGGAGACAGAAGG - Intronic
901461781 1:9396319-9396341 CTTTGGAAGGATGAGGCAGAAGG + Intergenic
901825073 1:11855991-11856013 CTTTGAAAGGCCGAGGCAGAAGG - Intergenic
901833346 1:11907308-11907330 CTGTGAAATGAGGAGAGAAAAGG - Intergenic
902452251 1:16504184-16504206 CTTTGGGAGGAGGAGACAGGAGG + Intergenic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903243689 1:22000630-22000652 CTCTGAAGGGAGGCGACAGCAGG - Intergenic
903284801 1:22269914-22269936 CTGTGAGGAGAGGTGACAGAAGG - Intergenic
903531476 1:24033717-24033739 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
903563465 1:24246466-24246488 CCCTGAAAGGAGGAGAGGGAAGG - Intergenic
904266670 1:29322272-29322294 GTGGGCAGGGAGGAGACAGAGGG + Intronic
904848400 1:33438416-33438438 CAGGGAAGGCAGGAGACAGAAGG - Intergenic
904879217 1:33682221-33682243 CTTTGTAAGAAGAAGACAGAGGG - Intronic
905000377 1:34663590-34663612 CTGGGAAAGGAAGAGAGAGGCGG - Intergenic
905036303 1:34920129-34920151 CTGTGAGAGGAGTAGAGAGAAGG - Intronic
905090531 1:35427751-35427773 CTTTGAAAGGATGAGGCAGGTGG - Intergenic
905302807 1:36997211-36997233 CCCTGGAAGCAGGAGACAGAGGG + Intronic
905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG + Intergenic
906042744 1:42801313-42801335 CTTTGGGAGGCGGAGACAGATGG - Intergenic
906085595 1:43130974-43130996 CTGTGCAAGGAACAGAAAGAAGG - Intergenic
906263381 1:44409453-44409475 CGCTGAAAGGAGGAGAAAGAAGG - Intronic
906688903 1:47779821-47779843 CTGTGAATGGTGGTGACAGGTGG + Intronic
907332991 1:53683493-53683515 CTGTGAAATGGGGAGAATGAGGG + Intronic
907943213 1:59108657-59108679 TTGGGAAAGCAGAAGACAGATGG + Intergenic
907998268 1:59654886-59654908 CTATAAAAAGAAGAGACAGATGG - Intronic
908364651 1:63408165-63408187 TTGGGAAAGGAGGAGGGAGAAGG - Intronic
909566000 1:77054267-77054289 GTTTGAAAGTTGGAGACAGATGG - Intronic
909607197 1:77519436-77519458 CTGTGAAAAGAGGAGACTTTAGG - Intronic
909871808 1:80750024-80750046 ATCTGAAAGGAGGAACCAGATGG - Intergenic
911165674 1:94722355-94722377 GTGGGAAAGGAGGGGACAGGGGG + Intergenic
911527890 1:99007296-99007318 CATTTAAAGGAGAAGACAGAAGG - Intergenic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
911961425 1:104307929-104307951 GTGGGAAAATAGGAGACAGATGG + Intergenic
912041109 1:105391896-105391918 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
912134764 1:106647608-106647630 CTTTAAAAGAAGGAGACAAAAGG - Intergenic
912739241 1:112178206-112178228 CTGTGAAAGGTGGGGGCAGGGGG - Intergenic
913387554 1:118276083-118276105 CAGGGAAAGGAGGAGACAGAAGG + Intergenic
913594587 1:120361043-120361065 TTGTGAAAGGAGGGGAAAGCCGG + Intergenic
914017677 1:143835529-143835551 GGGTGAAAAGAGGAGAGAGAAGG - Intergenic
914092678 1:144517943-144517965 TTGTGAAAGGAGGGGAAAGCCGG - Intergenic
914305853 1:146415932-146415954 TTGTGAAAGGAGGGGAAAGCCGG + Intergenic
914519521 1:148402963-148402985 CTTTGAAAGTAAGTGACAGATGG - Intergenic
914596203 1:149156874-149156896 TTGTGAAAGGAGGGGAAAGCCGG - Intergenic
914656287 1:149744064-149744086 GGGTGAAAAGAGGAGAGAGAAGG - Intergenic
914695766 1:150078054-150078076 CATGGAAATGAGGAGACAGAAGG - Intronic
914931311 1:151936387-151936409 TTGGGAAAGGAGGAGAGATAAGG - Intergenic
915083759 1:153370284-153370306 CTGGGAAAGGAGGAAAGATAAGG - Intergenic
915167106 1:153954101-153954123 CTGAGAGAGGTGGAGACAGTTGG - Intronic
915940746 1:160116723-160116745 CTGGCAAAAGAGGACACAGAGGG + Intronic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
916702377 1:167311025-167311047 CTGGGAAGAGAGGAGAAAGAGGG + Intronic
916930667 1:169575316-169575338 ATGTGAAAGGAAGGGGCAGAAGG + Intronic
917052178 1:170937048-170937070 CTGGGAAAGGAGGAGAGATAAGG + Intronic
917102568 1:171460816-171460838 CTTTGGAAGGCGGAGACAGGCGG + Intergenic
917509978 1:175661862-175661884 CTGTGGAGGCAGGAGAAAGAGGG - Intronic
917817961 1:178729842-178729864 CTCTGAAAGCAGGACACAGGAGG - Intronic
918021288 1:180694370-180694392 TTGTGAAAGGAGCAGTCAAATGG + Intronic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
918808198 1:189078239-189078261 CTGTGAAGGGAAGAAACAGCTGG + Intergenic
919389418 1:196963587-196963609 CTTTGGAAGGCGGAGGCAGACGG + Intergenic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
921334919 1:214076332-214076354 CTGGGAAAGGAAGAGGAAGAAGG + Intergenic
921770331 1:219029523-219029545 AAGTGAAAGTAGGACACAGAAGG + Intergenic
922319202 1:224470561-224470583 CTTTGAAAGGCCGAGGCAGAAGG - Intronic
922659746 1:227419346-227419368 CTGTCCAAGGAGGAGACACTTGG + Intergenic
922957288 1:229613978-229614000 CTGTGCAAGAAGGGGACAGAGGG + Intronic
923059615 1:230458812-230458834 ATGTGAAAAGAGGAAATAGAGGG - Intergenic
923713570 1:236406195-236406217 CTGTGATAGGAGGAGGGAGAAGG + Intronic
923779232 1:237007417-237007439 CAGTAAAGGGAGGAGAGAGAGGG - Intergenic
923811189 1:237318634-237318656 CTGACAAAAGAGAAGACAGAAGG - Intronic
924455696 1:244217335-244217357 TTGTCAAAGGAGGAAACCGAGGG - Intergenic
1063373583 10:5538100-5538122 TGGTGAAAGGAAGAGAGAGAGGG - Intergenic
1063415818 10:5871769-5871791 CTGGGAAAGGAGCCCACAGAGGG - Intronic
1063471748 10:6293256-6293278 CTGTGAAATCAACAGACAGAAGG - Intergenic
1064185004 10:13153863-13153885 CAGAGAAAGGAAGAGACAAATGG - Intergenic
1064199016 10:13269056-13269078 CTGGGAAGGGAGGAGAGATAAGG + Intergenic
1065464215 10:26001736-26001758 CTTTGAAAGGATGAGGCAGGAGG + Intronic
1065470195 10:26072180-26072202 ATGTCAAAGGAGGTGACAGGAGG - Intronic
1065638533 10:27755401-27755423 CTGTGAAGTGAGGAGTCGGAAGG - Intergenic
1065810394 10:29437984-29438006 CAGAGAGAGGAAGAGACAGAGGG - Intergenic
1065843230 10:29723124-29723146 CTTTGAAAGGCTGAGGCAGAAGG + Intronic
1066166680 10:32796069-32796091 CTGAGGACAGAGGAGACAGAGGG - Intronic
1066454117 10:35558289-35558311 CTGGGAAAGAAGAAGCCAGAAGG + Intronic
1066705635 10:38175014-38175036 CTGTGGAAGGAAGAAACAGAGGG + Intergenic
1067242091 10:44505863-44505885 CTGTGAGATGAGGAGACTGATGG + Intergenic
1067325491 10:45262119-45262141 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1067431846 10:46250468-46250490 CTGTGGGAGGAGGGGGCAGATGG - Intergenic
1067441574 10:46311710-46311732 CTGTGGGAGGAGGGGGCAGATGG + Intronic
1068338719 10:55673096-55673118 GAGTGAAAGGAAGAGAGAGAAGG + Intergenic
1069240245 10:66129769-66129791 CAGTGAGGGGAGGACACAGATGG - Intronic
1070170391 10:73928469-73928491 CTGGGAAGGGAGCAGACAGAAGG + Intergenic
1070383752 10:75904972-75904994 CAGTGGAAGGAGGGGAGAGAGGG + Intronic
1070825423 10:79387792-79387814 CTGGGAATGGAAGAGTCAGAAGG + Intronic
1071218699 10:83437222-83437244 ATGTAAAAGAAGGGGACAGAGGG - Intergenic
1071288590 10:84171948-84171970 CTGGGAAACGAGGTGACTGACGG - Intergenic
1071399658 10:85256891-85256913 CTGGCAAAGGAGGAGATGGAAGG - Intergenic
1071828686 10:89350820-89350842 CTGGGAAGGGAGGAGAGATAAGG + Intronic
1072202309 10:93171537-93171559 CTTTGAAAGGCCGAGACAGGAGG + Intergenic
1072486183 10:95858200-95858222 CTGTGAAAGCAGATAACAGAGGG + Intronic
1072749317 10:97965923-97965945 CTTGGAAAGGAGATGACAGATGG + Intronic
1072898412 10:99387259-99387281 CTGTGATTTGAGGAGACAGCTGG + Intronic
1073045953 10:100638212-100638234 CTGGGAAAGGAGCAGAAGGAGGG + Intergenic
1073759831 10:106617291-106617313 CAGAGAGAGGAGGAGGCAGAAGG - Intronic
1074640646 10:115376600-115376622 CTTTGAAAGGCTGAGGCAGAAGG - Intronic
1075148987 10:119909361-119909383 CTGTGAGAGGCTGAGACAGGTGG + Intronic
1075223209 10:120602159-120602181 CTTTGAAGGTAGGAGCCAGAGGG - Intergenic
1075420274 10:122295298-122295320 CAGTCAAAGGGGGAGAAAGAGGG + Intronic
1075617597 10:123902994-123903016 CTGTGAAGGGAAGTGCCAGAGGG - Intronic
1075724739 10:124605481-124605503 CTGTGGAAGGAGCATACAGTGGG + Intronic
1076181378 10:128411539-128411561 CAGAGAAAGGAAGAGACAAAGGG - Intergenic
1076412623 10:130262723-130262745 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076412846 10:130264164-130264186 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1077047632 11:553420-553442 CTGTGGAGGGGGCAGACAGAGGG + Intronic
1077608919 11:3631905-3631927 TTGTGAAAGGAAGTGAGAGAGGG + Intergenic
1078187299 11:9062995-9063017 CTTTGAGAGGACGAGACAGGTGG + Intronic
1078774579 11:14382626-14382648 TTGTGACAGGAGGAGGCAGGGGG + Intergenic
1078910080 11:15722991-15723013 CTGTGAAAGGGAGGGGCAGAGGG + Intergenic
1080753995 11:35178035-35178057 ATATGAAAGGAGCAGAGAGAGGG + Intronic
1080850825 11:36068409-36068431 CTGTAAAAGGAAGATAAAGATGG - Intronic
1080873576 11:36257796-36257818 CTGTGGAGGGTGGAGGCAGATGG + Intergenic
1080887509 11:36380144-36380166 CTCTAAAATGAGGAGACAGGAGG + Intronic
1081010247 11:37801875-37801897 GTGTGAGAGAAAGAGACAGAGGG + Intergenic
1081010253 11:37801927-37801949 GTGTGAGAGAAAGAGACAGAGGG + Intergenic
1081184790 11:40028979-40029001 CTGTGAGAGGAGGTGCCAGGTGG + Intergenic
1081304547 11:41495654-41495676 CTTTGAAAGGCTGAGACAGGTGG + Intergenic
1081596972 11:44466283-44466305 CTGTGGAAGAAGGAGCCAGTAGG - Intergenic
1081817492 11:45957626-45957648 CTGTGAAAGCAGTACTCAGAGGG + Intronic
1081864613 11:46352651-46352673 CTGTTCAAGGAGGAGGCAGAGGG - Intronic
1082030403 11:47599452-47599474 GTGAGAAAGGAAGAGACAGATGG + Intergenic
1082134923 11:48537001-48537023 ATGGGAAAGGAGCACACAGATGG - Intergenic
1082627217 11:55500725-55500747 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1083407520 11:62468594-62468616 CTGAGAAATCAGGAGAAAGAGGG + Intronic
1083511677 11:63214534-63214556 TTGGGAAAGGAGGAGAGATAAGG - Intronic
1083596689 11:63920981-63921003 CCGTGCAAGGAGGCGGCAGAGGG + Intergenic
1083877047 11:65529737-65529759 TTCACAAAGGAGGAGACAGAGGG - Intronic
1084054556 11:66624191-66624213 CTGATAAAGCAGCAGACAGAGGG - Intronic
1084506290 11:69570386-69570408 CTCTGAGAGCAGGAGATAGATGG - Intergenic
1084549129 11:69830578-69830600 GAGGGAAAGGGGGAGACAGAAGG - Intergenic
1085286756 11:75367646-75367668 CTTTGGAAGGCTGAGACAGACGG + Intergenic
1085483167 11:76839320-76839342 CTGCAAAATGAGGAGACTGAGGG - Intergenic
1085986518 11:81794062-81794084 CGGTGAAAGCAGGAGCAAGAGGG - Intergenic
1086036494 11:82421667-82421689 CTGTGAAAAGGAAAGACAGAGGG + Intergenic
1087468327 11:98539015-98539037 CTGTGAAAAGAGGAAAAAAAGGG + Intergenic
1087788801 11:102385287-102385309 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1088305342 11:108401441-108401463 CTGGGAAAGAAGGAGAGATAAGG - Intronic
1088692167 11:112337448-112337470 TTCTGAAAAGAGGAGACAGAAGG - Intergenic
1088726532 11:112642084-112642106 AAGAGAAAGGAGGAGAAAGAAGG - Intergenic
1088737730 11:112741962-112741984 CTGAGACAGGGGGAGACAGGGGG + Intergenic
1089156357 11:116405911-116405933 CGGTGGAGGGAGGAGAAAGAAGG + Intergenic
1089254048 11:117184702-117184724 CTGTGATAGGAGGGGAAAGAAGG + Intronic
1089279958 11:117366996-117367018 CTGTGAAAGGAGGAGACAGAAGG + Intronic
1089344922 11:117785031-117785053 CTGGGGAAGGAGGACACTGAAGG - Intronic
1089654073 11:119934438-119934460 CTGTGGTAGGAAGAGGCAGAAGG - Intergenic
1089958627 11:122596141-122596163 CTTTGAAAGCAGATGACAGAGGG - Intergenic
1090032771 11:123221450-123221472 TTGGCAAAGAAGGAGACAGAAGG - Intergenic
1090117653 11:123991244-123991266 TTTTGAAAGGAGTATACAGACGG - Intergenic
1090401749 11:126453681-126453703 CTGGGAAGGGAGGAGGCGGAGGG - Intronic
1091106324 11:132922765-132922787 CTGTGAAGGGAAGACACAGCGGG + Intronic
1091153963 11:133356474-133356496 GTGAGAAAGTAGGAGCCAGAGGG + Intronic
1091792746 12:3281064-3281086 CAGTTAAGGGAGGAGACAAAGGG - Intronic
1091948686 12:4572823-4572845 CTGTTAAATGGAGAGACAGAGGG - Intronic
1092040178 12:5377262-5377284 CTGTGAGAGTGGGAGAGAGATGG + Intergenic
1092056801 12:5514109-5514131 CTGTGGGAGGATGAGACACATGG + Intronic
1092064117 12:5575377-5575399 CAGAGAGAGCAGGAGACAGAGGG + Intronic
1092689636 12:11093664-11093686 CTGTGATAGGAGGATACTGCAGG - Intronic
1093151345 12:15625441-15625463 CTGTAAAAGGAGCAGAAAAATGG - Intronic
1093662230 12:21770517-21770539 CTGTGAAAGAAGCAGAGGGAAGG + Intronic
1093901739 12:24643197-24643219 CTGTGAAAGAAAGAAAGAGAGGG + Intergenic
1094416222 12:30217890-30217912 ATGTGGAGTGAGGAGACAGATGG + Intergenic
1094650160 12:32368449-32368471 CTGTGGAAGGCCGAGGCAGAGGG + Intronic
1094738699 12:33264062-33264084 CTGTAAAAGGACTTGACAGAGGG + Intergenic
1095523199 12:43093309-43093331 CCGTGAAAGGAGGAGTCAATTGG + Intergenic
1095873506 12:47055964-47055986 CTGGGAAGGGAGGAGAGATAAGG - Intergenic
1095950069 12:47776966-47776988 CTGTGGCACGAGGAGACAGAGGG + Intronic
1096278955 12:50235175-50235197 CTTTGAAAGGCTGAGACAGGAGG - Intronic
1096578456 12:52569447-52569469 CAGTGGGAGGAGGAGACAGAGGG + Intronic
1096684529 12:53279132-53279154 CTTTGAAAGGCTGAGGCAGACGG - Intronic
1096975500 12:55697342-55697364 CTGTGACAGGATGTGACAGATGG - Intronic
1097242368 12:57584195-57584217 CTGGGAAAGAAAGAGAAAGAGGG - Intronic
1097844407 12:64351901-64351923 CTGTGAAGCGAGGACAGAGAAGG - Intronic
1098366224 12:69706057-69706079 CTGTGACAAGAGGAGAGACATGG - Intergenic
1098635504 12:72779816-72779838 CTGAGAGAGGAGCACACAGAAGG - Intergenic
1100123915 12:91400386-91400408 TTGTGATAGCAGGAGATAGAAGG - Intergenic
1101157505 12:101941657-101941679 CTGTTAGAGGAGGAAACTGAGGG + Intronic
1101407427 12:104441142-104441164 GAGTGAAAGAAGGAGACACATGG + Intergenic
1101858404 12:108463049-108463071 AGGGGAAAGGAGGAGAGAGAGGG + Intergenic
1101966928 12:109287963-109287985 CAGGAAGAGGAGGAGACAGAGGG + Intronic
1101992618 12:109499668-109499690 GTGTTAGAGGAGGAGACAGATGG + Exonic
1102207411 12:111099802-111099824 CTGGGCATGGAGGGGACAGAGGG - Intronic
1102226994 12:111235834-111235856 ATGTGGCAGGTGGAGACAGAGGG + Intronic
1102562356 12:113771130-113771152 CTGTGTTGCGAGGAGACAGACGG - Intergenic
1102786109 12:115606326-115606348 CTGCAAATGGAGGAGACAGGGGG + Intergenic
1102834863 12:116046728-116046750 CTTTGGGAGGACGAGACAGACGG + Intronic
1102970480 12:117162197-117162219 CACTGAAAGGAAGAGAAAGAGGG + Intronic
1103540344 12:121661867-121661889 CTGTGAAAGAAAGAAAGAGAAGG + Intronic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104512649 12:129394566-129394588 CTGGAGAAGGGGGAGACAGAGGG + Intronic
1104512679 12:129394820-129394842 CTGGGGATGGAGGTGACAGATGG + Intronic
1104761045 12:131297715-131297737 CTGAGAAAAGAGAAGACACAGGG + Intergenic
1104769225 12:131350450-131350472 CTGGGAAGGGAGGAGAGATAAGG + Intergenic
1104818733 12:131663077-131663099 CTGAGAAAAGAGAAGACACAGGG - Intergenic
1104873501 12:132017060-132017082 CAGTGAAGGGGGCAGACAGAAGG - Intronic
1104996358 12:132660098-132660120 CCTTGAAAGGAAGAGAAAGAAGG + Intronic
1105456207 13:20543543-20543565 CTGGGAAAGGAGGAGAGATGAGG - Intergenic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1107413872 13:40183044-40183066 CATTGAAAACAGGAGACAGAGGG - Intergenic
1107966636 13:45603653-45603675 CTGGGAAAGGGGGTGACAGAGGG - Intronic
1108257640 13:48626132-48626154 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1108286549 13:48914860-48914882 CTGTGAACGGATGAGAAAAAAGG - Intergenic
1108604247 13:52021526-52021548 ATGGGAAGGGAGGTGACAGAGGG + Intronic
1110873117 13:80475849-80475871 CTGTGAAAGGAGGAGTTACTCGG - Intergenic
1111308469 13:86448243-86448265 CTGTCTGAGGAGGAGATAGAGGG - Intergenic
1112012500 13:95303759-95303781 CTTTGAGAGGTGGAGACAGGAGG + Intergenic
1112850755 13:103703475-103703497 CAGTGAAATAAGGAGACAGCTGG - Intergenic
1113638414 13:111938196-111938218 CTGTGATATGAGCAGACAGAGGG + Intergenic
1113643305 13:111973696-111973718 CAGAGAGAGGAGGAGAGAGATGG - Intergenic
1113675957 13:112208183-112208205 CTGGGAAAGGAAGTTACAGATGG - Intergenic
1113899531 13:113788529-113788551 GTGTGGCAGGAGGAGACACAGGG - Intronic
1114042015 14:18687807-18687829 TTATGAGAGGAGGAGAAAGACGG + Intergenic
1114440441 14:22742378-22742400 AGGGGAAAGGAGTAGACAGAGGG - Intergenic
1114650823 14:24283705-24283727 CTGTCAAGGGAGGAGGCAGGGGG - Intergenic
1115383603 14:32769289-32769311 CTGTGGGAGGAGGAGGCAGGCGG - Intronic
1115620859 14:35138871-35138893 ATGTGAACCCAGGAGACAGAGGG - Intronic
1115812395 14:37124171-37124193 CTTTGAGAGGTGGAGACAGGAGG - Intronic
1117074657 14:52090024-52090046 CAGCAAAAGGAGGAGACAGATGG - Intergenic
1117075186 14:52095340-52095362 CTGATAAAGGAGGAAATAGAAGG - Intergenic
1117909588 14:60624308-60624330 CTGGGAGAGGTGGAGAAAGAGGG - Intergenic
1118389862 14:65287169-65287191 CTGGGAAAGGAGGAGGCCCAGGG - Intergenic
1118510898 14:66472080-66472102 ATGTGAAAGGGGGAAAAAGATGG - Intergenic
1118817894 14:69325570-69325592 GTGTCAAAGGAGGGGAAAGAAGG + Intronic
1119388686 14:74275649-74275671 CACTGGAAGGGGGAGACAGATGG + Intergenic
1119453652 14:74735334-74735356 CTGGGAAAGGAGGAGAGATAAGG + Exonic
1119557043 14:75561202-75561224 CTGGGAAAGGAGGATGCAGGAGG - Intergenic
1119878467 14:78080362-78080384 CTTTGAAAGGCTGAGACAGGAGG - Intergenic
1120139064 14:80907298-80907320 TTAGGTAAGGAGGAGACAGAGGG - Intronic
1120356808 14:83444648-83444670 GTATTAAAGAAGGAGACAGAAGG - Intergenic
1120525162 14:85568918-85568940 GAGGGAAAAGAGGAGACAGACGG - Intronic
1120861088 14:89255640-89255662 CTATGAAAGGAGGATACAAAAGG + Intronic
1121377573 14:93428444-93428466 TTGAGATAGGTGGAGACAGAAGG + Intronic
1121799659 14:96764038-96764060 CTGTGGTGGAAGGAGACAGAAGG + Intergenic
1121860172 14:97309887-97309909 CTGTGGAAGCAAGAGAGAGAGGG - Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1123047408 14:105525876-105525898 CTGACATAGGAGGAGACTGAGGG - Intergenic
1123633653 15:22280352-22280374 CTTTGGGAGGCGGAGACAGAAGG + Intergenic
1123990189 15:25677720-25677742 CTGTTAAATGGGGAGACAAAGGG - Exonic
1124199314 15:27663794-27663816 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1124582118 15:30966127-30966149 TTGTCAAAGGAGGAGTCTGAAGG + Intronic
1124686661 15:31788719-31788741 ATGTGAATGGAGGAGAGAAAAGG + Intronic
1124706363 15:31969865-31969887 CTCTGAAAGGTGGAGAAAGGAGG + Intergenic
1125240228 15:37565638-37565660 AGGAGAAAGGAGGGGACAGAGGG + Intergenic
1125451714 15:39815180-39815202 CTGTGTGTAGAGGAGACAGAAGG + Intronic
1125981941 15:44010238-44010260 GTGTGTAAAGTGGAGACAGAAGG - Intronic
1126078849 15:44939034-44939056 CTGTGGGAGGTGGAGACAGGCGG - Intergenic
1126812060 15:52416814-52416836 CTGGGAAAGGAGGAGAGATAAGG + Intronic
1127271971 15:57409622-57409644 GTGTGAAAGGGGGAGGGAGAAGG + Intronic
1127318423 15:57818769-57818791 CTGTTAAAATAGGGGACAGAAGG - Intergenic
1127486613 15:59423966-59423988 CAGTGAAAGGAGCAGACAAATGG - Intronic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1127959374 15:63879465-63879487 TGGTGAAAGGAGGAGGCAGGAGG - Intergenic
1128224191 15:65990305-65990327 CTTTGAAAGGCTGAGGCAGAAGG + Intronic
1128369543 15:67030284-67030306 GAGTGAAAGGTGGAGATAGAGGG + Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129272671 15:74427755-74427777 CTGTGACAGGAGGTGAGAGCAGG - Intronic
1130184527 15:81667305-81667327 CTTTGGGAGGTGGAGACAGATGG + Intergenic
1130290661 15:82597615-82597637 TTGGGAAAGGAGGAGAGACAAGG + Intronic
1130343075 15:83015615-83015637 CTTTGAGAGGCTGAGACAGAAGG - Intergenic
1130952204 15:88601448-88601470 CTTTGGAAGGCCGAGACAGATGG - Intergenic
1131082248 15:89546454-89546476 TTGTGAAAGGAGAAGAAAAAGGG - Intergenic
1131329209 15:91480661-91480683 CTGTGTAAGCAGGAGACAGAAGG + Intergenic
1131759135 15:95600936-95600958 TTGGGAAAGGAGGAGAGGGAAGG + Intergenic
1132284369 15:100650439-100650461 CAGGGATAGGAGGAGGCAGAGGG + Exonic
1132459060 16:41149-41171 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1132549737 16:549449-549471 CTGTGAGAAGAGGAGGCAGCCGG - Exonic
1133279069 16:4655055-4655077 GGGTGCAAGGAGGGGACAGAGGG - Intronic
1134204521 16:12226411-12226433 GTTTAAAAGGAGGAGAGAGAGGG + Intronic
1134771648 16:16814438-16814460 CAGAGAAAGCAGGAAACAGAAGG - Intergenic
1134772328 16:16820506-16820528 CTTCAAAAGGAGGAAACAGAAGG - Intergenic
1134843025 16:17416499-17416521 CTGAGAAAGGAGGGGACTGTGGG + Intronic
1135077902 16:19410190-19410212 CTGGGAAAGGAGGGGAGAGAAGG + Intergenic
1135398964 16:22152490-22152512 CTCTGGAAGGAAGGGACAGAGGG - Exonic
1135414562 16:22258722-22258744 CTGTGATTGGAGGGGACAGGTGG + Intronic
1135891792 16:26363890-26363912 GTGTGAAAGGCAGAGACTGAGGG - Intergenic
1135960986 16:26994380-26994402 CTCAGAAAGGATCAGACAGAGGG - Intergenic
1136059789 16:27718637-27718659 CTGACAAAGGAAGAGACTGATGG - Intronic
1137490208 16:48926081-48926103 TGGTGAAAGCAGGAGCCAGAGGG - Intergenic
1137608536 16:49803375-49803397 CTCTTACAGGAGGAGACAGCTGG - Intronic
1137626554 16:49912525-49912547 CTGTGAACAGAGGACCCAGAAGG - Intergenic
1137984611 16:53097403-53097425 CTGTGAAAGAAAGAGAAAGAAGG - Intronic
1138202543 16:55100921-55100943 CTGTGGAAGGAAGAGAGGGAGGG + Intergenic
1138235693 16:55380398-55380420 CTCAGAAAGGAGAAGACCGATGG + Intergenic
1138454025 16:57110879-57110901 CTCTGTAAAGAGGACACAGAAGG - Exonic
1139139176 16:64240250-64240272 CTTAGAAAGCATGAGACAGAGGG - Intergenic
1139188909 16:64838994-64839016 CTGTGCAAGGTGGCAACAGAAGG - Intergenic
1139369436 16:66457669-66457691 CTCAGAGAGGAGGACACAGAAGG - Intronic
1139584159 16:67890712-67890734 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1139608124 16:68034607-68034629 CTTTGGGAGGATGAGACAGATGG - Intronic
1139705800 16:68739506-68739528 CTTTGAGAGGCTGAGACAGAAGG - Intronic
1139915060 16:70422975-70422997 CTTCCAAAGGAGGAGACAGAGGG + Intronic
1139963498 16:70731377-70731399 CAGGAAAAGGAGGAGAGAGAAGG + Intronic
1140404129 16:74696541-74696563 CTTTGAGAGGAAGAGACAGGAGG + Intronic
1141036369 16:80629794-80629816 TTGTGAATGGAGGAACCAGAAGG - Intronic
1141448905 16:84083425-84083447 CAGAGAAAGGAGGAAAGAGATGG + Intronic
1141625358 16:85258634-85258656 CTGTGGGAGGAGGAGGGAGAGGG + Intergenic
1142358753 16:89616372-89616394 CTGTGAGAGGATCGGACAGACGG + Intronic
1142430630 16:90024581-90024603 CTGGGAAGGGAGGAGAGACAAGG + Intronic
1143101962 17:4509463-4509485 CTGTGAAAGGAGGAGAGGAAAGG + Intronic
1143340334 17:6206153-6206175 CTGGGAACGTAGGTGACAGAAGG + Intergenic
1143743338 17:8970952-8970974 CTGAGGAAGGAGAAGACAAAAGG + Intergenic
1144316336 17:14065578-14065600 CTTTGAAAGGCTGAGGCAGAAGG + Intergenic
1147226358 17:38981095-38981117 CTGGGAAATTAAGAGACAGAGGG + Intergenic
1147808977 17:43153354-43153376 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1148464775 17:47858213-47858235 CTGGGCAAGGAGGAGAAAGATGG - Intergenic
1148897007 17:50844654-50844676 CTGCAACTGGAGGAGACAGAAGG + Intergenic
1148916392 17:50983344-50983366 TTTTGAAAAGAGGAGACATAGGG - Intronic
1149623969 17:58066689-58066711 CTGTGAAAGGAAAAGAAAGAAGG + Intergenic
1149626266 17:58083090-58083112 CTGAGAGAGGAGGAGAGGGAAGG - Intergenic
1150417057 17:64996237-64996259 CTCTGTAAGAGGGAGACAGAGGG + Intergenic
1150472637 17:65450126-65450148 CTGTGAAAGGTAGAGCCAAATGG - Intergenic
1150794609 17:68227686-68227708 CTCTGTAAGAGGGAGACAGAGGG - Intergenic
1150850970 17:68703429-68703451 GTGTGAAAGGAGAAGAGACAGGG + Intergenic
1151807452 17:76414919-76414941 ATTTGAAGGGAGGGGACAGATGG + Intronic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1151891340 17:76952408-76952430 CTGTAAAATGAGGGGACAGGAGG - Intergenic
1152067632 17:78120531-78120553 CTCTGAAGGGTGGAGACACAGGG + Intronic
1152796735 17:82311278-82311300 CTGAGAAAGTACGAGAAAGAAGG + Intergenic
1153641183 18:7158505-7158527 ATCTGAAAGGAGGAGAAAGAGGG - Intergenic
1153749901 18:8218662-8218684 GTAGGAAAGGAGAAGACAGAGGG - Intronic
1153771505 18:8420602-8420624 CTGTAAAAGGAGAAGAGACACGG - Intergenic
1153828428 18:8898426-8898448 CTTTGGAAGGAGGAGAAAGATGG + Intergenic
1154132603 18:11750242-11750264 CTGAGAAAGGAGCAGGTAGAAGG + Intronic
1154189430 18:12216535-12216557 TTTGGAAAGGAGGAGATAGAAGG - Intergenic
1154280472 18:12997553-12997575 CTGGGAAAGGAGGAGAGATAAGG + Intronic
1154940271 18:21106122-21106144 GGGTGAGCGGAGGAGACAGAAGG - Intronic
1155457297 18:26031767-26031789 GTGTGGAAGGAGGCAACAGAGGG + Intronic
1156863439 18:41864349-41864371 CTGCGTAAGGTGGACACAGAGGG + Intergenic
1157077644 18:44483022-44483044 CCGGGACAGGAGGAGACACAGGG - Intergenic
1157284037 18:46364993-46365015 CTGTGACAGGAGAAGAGTGAGGG + Intronic
1157605317 18:48922771-48922793 CTGTGGAAGGAGGGGAGAGAGGG - Intronic
1157921160 18:51713818-51713840 CTGTGATAGGAGGAGTCTCAGGG + Intergenic
1158564365 18:58542221-58542243 GTCTTAGAGGAGGAGACAGAGGG - Intronic
1159209944 18:65305605-65305627 CTGTGAAAGGGAGAGAAAGGAGG - Intergenic
1159364850 18:67452243-67452265 ATCTGAAATGAGGAAACAGAAGG - Intergenic
1160196981 18:76763780-76763802 CTTTGGAAGGAGGAGGCAGGAGG - Intergenic
1161178774 19:2865478-2865500 CTGGGAAGGGAGGAGAGATAAGG - Intergenic
1161787026 19:6333120-6333142 CTGTGGTAGGGGGAGGCAGAGGG - Intronic
1162175122 19:8824616-8824638 CTGCGATGGGAGGAGGCAGAAGG - Intronic
1162556955 19:11392984-11393006 CTGTGACAGGAAGAGGAAGAAGG + Intronic
1162660381 19:12163872-12163894 CTGTGCATAGAGGAGACAAAAGG - Intronic
1163780935 19:19247717-19247739 ATGGGAATGAAGGAGACAGACGG - Intronic
1163915584 19:20238074-20238096 CTGCGAGAGGAAGAGACAGGAGG + Intergenic
1164011550 19:21207013-21207035 TTGGGAAAGGAGGAGAGATAAGG + Intergenic
1164387913 19:27793080-27793102 CTGTGAAAGGCGGACGCAGCAGG - Intergenic
1164526370 19:29016409-29016431 GAGAGAAAGGAGGAGAGAGAGGG - Intergenic
1164682851 19:30147211-30147233 CTATGAGAGGAAGAGAAAGATGG + Intergenic
1164811444 19:31159933-31159955 CTTTGGAAGGCTGAGACAGAAGG - Intergenic
1165080783 19:33304774-33304796 GGGAGGAAGGAGGAGACAGAAGG + Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1166303864 19:41927000-41927022 CCGAGAAAGGAAGAGACACAGGG + Intronic
1166423142 19:42653697-42653719 CTCTGAAGGGAAGAGACAGATGG + Intronic
1166534021 19:43560749-43560771 CAGTGTACGGAGGAGACAGAAGG - Intronic
1166856455 19:45784709-45784731 CTGTGAACTACGGAGACAGAGGG + Exonic
1166985525 19:46658147-46658169 CTTTGAGAGGCTGAGACAGAAGG + Intronic
1167168192 19:47813607-47813629 CAGAGAAAGGGGGAGACAGAGGG - Intronic
1168192720 19:54751495-54751517 CTGAGAAAGCAGGAGAAAGCTGG + Intronic
1168194808 19:54766323-54766345 CTGAGAAAGCAGGAGAAAGCTGG + Intronic
1168207880 19:54865653-54865675 CTGAGAAAGCAGGAGAAAGCTGG + Intronic
1168328904 19:55554647-55554669 GTGTGGAATGAGGAGACGGATGG + Intergenic
1168376253 19:55882307-55882329 CTGTGAAAGGCTGAGGCAGGTGG - Intergenic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
1168543314 19:57230829-57230851 CCGAGAAGGAAGGAGACAGAGGG - Intronic
925017927 2:545887-545909 CAGTGAACTGAGGAGACTGAGGG - Intergenic
925296257 2:2779596-2779618 CTGTGCAAGCAGGAGGCAGGGGG - Intergenic
925831980 2:7904587-7904609 CTGTGTGAGCAGGGGACAGAGGG - Intergenic
926092030 2:10057642-10057664 AGGGGGAAGGAGGAGACAGAAGG - Exonic
927403178 2:22737680-22737702 CTGGGAGAGGAAGAGACTGAAGG - Intergenic
927864781 2:26581442-26581464 CTGTGAACCCAGGAGTCAGAGGG - Intronic
927996934 2:27493479-27493501 CTGAGAAGGGAGAAGGCAGAAGG + Intronic
928642422 2:33314304-33314326 CTTTGGAAGGCGGAGACAGGAGG + Intronic
928726209 2:34176712-34176734 CTGTGATAGGAGAAGAGAAATGG + Intergenic
929663710 2:43816451-43816473 CAGTGAAAGGCACAGACAGAAGG + Intronic
929788016 2:45005872-45005894 GGGTAAAAGGAAGAGACAGAGGG + Exonic
929880907 2:45836711-45836733 GTGAGAAAGGAGGAGGCAGACGG - Intronic
929961584 2:46500447-46500469 GTAAGAAAGGAGGAGAAAGAGGG + Intronic
930136303 2:47906343-47906365 GTGTGAAGGGAGGAGATAGGGGG + Intergenic
930184076 2:48394277-48394299 CTTTGAAAGGTCGAGGCAGAAGG + Intergenic
930359137 2:50357031-50357053 CTTTGGAAGGCGAAGACAGAAGG + Intronic
931091895 2:58895259-58895281 AAGTGAAGGGAGAAGACAGAAGG + Intergenic
931616864 2:64168064-64168086 CTGTGATAGGAGTAGGCAAATGG - Intergenic
931905099 2:66833994-66834016 CAGTGAAAGAAAGAGGCAGAAGG - Intergenic
932327625 2:70873537-70873559 CTGTTAAAGAAGGAGACAGAAGG - Intergenic
933203769 2:79481349-79481371 ATGAGAAAGTAGGAGACAGAGGG - Intronic
933203791 2:79481799-79481821 CTTTAAAAGAAGAAGACAGACGG + Intronic
934692839 2:96374963-96374985 CTTTGAAAGGAAGAGGCAGGAGG + Intergenic
934855815 2:97729100-97729122 TTGTGAAAGGAGCAGTCAGTAGG - Intronic
935184781 2:100722171-100722193 ACCTGAAAGGAGGAGACAGAGGG + Intergenic
935294239 2:101634951-101634973 CTGGGGAAGGAGGAGGCAGGTGG - Intergenic
936281955 2:111149330-111149352 TTTTGAAAGGAGAAGAAAGAGGG - Intronic
936286739 2:111187093-111187115 GTGTGAGAGGGGGTGACAGAGGG - Intergenic
938102305 2:128505343-128505365 CTGTGACAGGTGGTGACAGGTGG + Intergenic
938268202 2:129944725-129944747 TTATGAGAGGAGGAGAAAGACGG - Intergenic
938494448 2:131786038-131786060 CTGGGAAAGGAGGAGAGATGAGG - Intergenic
938692298 2:133802713-133802735 CTTTGAAAGGAGGAGGGTGAGGG + Intergenic
938810360 2:134847048-134847070 CAGTGAAAGGGGGAGATAGTAGG + Intronic
939448486 2:142340753-142340775 CTTTGAAATGAAGACACAGATGG - Intergenic
939939977 2:148337579-148337601 CTGGGGAATGAAGAGACAGATGG + Intronic
940344966 2:152619585-152619607 CTGGGAGAGGAGGAGGCGGAGGG - Exonic
940647194 2:156404122-156404144 CTTTGAGAGGCCGAGACAGAAGG + Intergenic
940931073 2:159432203-159432225 CTGTGGAATGAGGAGAGGGAAGG + Intronic
941690287 2:168494410-168494432 CTGTGAAATGAGGATAAAAATGG + Intronic
941908754 2:170742318-170742340 CTGTGATAAGAAGAGACTGAAGG + Intergenic
942014998 2:171804666-171804688 CTTTGGGAGGAGGAGGCAGAAGG + Intronic
942233500 2:173881691-173881713 CTTTGAAAGGAGGAGCCACAAGG + Intergenic
942658796 2:178242419-178242441 CTGGGAAAGGAGGAAAGAGGAGG - Intronic
943008243 2:182413137-182413159 TTGTGAAAGGAGGAAAGAGATGG + Intronic
943608357 2:190002753-190002775 CTCTGTAGGTAGGAGACAGAAGG - Intronic
943615753 2:190090248-190090270 CTGTGAAAGGAGTGTATAGAAGG - Intronic
943850723 2:192718907-192718929 CTGTGCAAGGATGTGAGAGAGGG + Intergenic
943862844 2:192890663-192890685 GTGTCAGAGGAGGAGATAGAGGG - Intergenic
944380337 2:199101914-199101936 GTGTGAAACGAGGAAATAGATGG - Intergenic
944506599 2:200418741-200418763 TTGTAAAATGAGGACACAGAAGG - Intronic
945384572 2:209181657-209181679 CTATGCAAGGTGGAGACAAAGGG - Intergenic
945434568 2:209803978-209804000 CTGTGAAAGGCTGAGGCAGGAGG - Intronic
945675673 2:212852655-212852677 CTTTGAAAGGAAGAAAGAGAAGG - Intergenic
946077981 2:217091580-217091602 CTGGGACAGGAGGAGATAGAAGG + Intergenic
946905024 2:224407451-224407473 CTGGAAAAGGGGGAAACAGATGG - Intergenic
947101387 2:226625111-226625133 CAGTCAAAGGAGAAGACAAAGGG + Intergenic
948527561 2:238580958-238580980 CGGGGGAGGGAGGAGACAGAGGG - Intergenic
948612151 2:239176568-239176590 AAGTGGAAGGAGGAGACAGACGG + Intronic
1169325854 20:4675797-4675819 CTATAAAAGGAGGAGAGAGTGGG + Intergenic
1169400090 20:5272253-5272275 CGGGGAAAGCAGGATACAGAAGG - Intergenic
1170128507 20:12992089-12992111 CTTTGGAAGGCTGAGACAGATGG - Intergenic
1170129822 20:13007377-13007399 ATGTGAAAAGAGGAAAGAGATGG + Intergenic
1170329578 20:15193752-15193774 CTGTGAGAGTAGGAGAATGAAGG - Intronic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171256642 20:23693589-23693611 CTGTGACAGGAGGAGAGGGCAGG - Intergenic
1171279533 20:23884063-23884085 CTGTGACAGGAGGAGAGGGCAGG - Intergenic
1171323578 20:24269449-24269471 CAGTGAAAGCAGTATACAGAGGG - Intergenic
1171493767 20:25539826-25539848 CTGTGGAAGGATGATAGAGAAGG - Intronic
1172060702 20:32185413-32185435 ATGTGAAAGGAGGTGGAAGAAGG + Intergenic
1172122484 20:32607105-32607127 CAGAGACAGAAGGAGACAGAGGG - Intronic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172477375 20:35248976-35248998 TGGTGAAAGGAGGAGGCAGCGGG + Intronic
1172621276 20:36320014-36320036 CTGGGAGAGGGGGACACAGAGGG - Intronic
1172621311 20:36320122-36320144 CTGGGAGAGGAAGACACAGAGGG - Intronic
1173628963 20:44495661-44495683 CTGTGTAAGGAGGGGGCAGGGGG - Intergenic
1173868632 20:46328603-46328625 CTGTGGAAGGAGGAGAGGAATGG - Intergenic
1175336698 20:58200814-58200836 CTGTGAAAGAAGGACCCTGAAGG + Intergenic
1175403050 20:58711406-58711428 CTCTGAGAGGAGGAGGCTGAGGG + Intronic
1175988624 20:62776735-62776757 CTGTGGAAGGAGGACAGAGGAGG + Intergenic
1176032655 20:63021119-63021141 CTCTGAGCTGAGGAGACAGAAGG - Intergenic
1176346129 21:5749497-5749519 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1176352943 21:5870081-5870103 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1176498698 21:7574958-7574980 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1176540450 21:8147567-8147589 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1176559401 21:8330612-8330634 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1176613491 21:9008339-9008361 CTGGGAAAGGAGGAGAGATGAGG + Intergenic
1177611571 21:23456111-23456133 CTGTAACTGGAGGAGCCAGAAGG + Intergenic
1177685537 21:24433047-24433069 GTATGGAAGAAGGAGACAGATGG + Intergenic
1178092608 21:29180440-29180462 CTGGGAAAGTAAGAGAGAGAGGG - Intergenic
1178467882 21:32865264-32865286 GTGTTAAAGGAGCAGAGAGAAGG + Intergenic
1178716911 21:34973327-34973349 CTGTGAATGGAGAAGAACGAGGG + Intronic
1178804662 21:35828997-35829019 CTGGGACAGGTGGAGAGAGAGGG + Intronic
1178894548 21:36548135-36548157 CAAGGAAAAGAGGAGACAGAGGG - Intronic
1178993723 21:37377709-37377731 CTGTGAGAGGACAAGACAGGAGG - Intronic
1179598785 21:42461738-42461760 AGGTGAAAGGAGGAGAGAGGAGG - Intergenic
1181148352 22:20864838-20864860 CTGAAAAAGGAGGAGAGAGTTGG + Intronic
1181481925 22:23205377-23205399 CCGTGAGAGGAGGAGAAGGAGGG - Intronic
1181593413 22:23897955-23897977 ATGGGAAGGGAGGAGACAGCAGG + Intronic
1181926039 22:26359552-26359574 CTTTGAAAGAACGAGACAGGAGG + Intronic
1182100550 22:27654725-27654747 CTGGGGAAGCAGGCGACAGAGGG - Intergenic
1182133217 22:27874423-27874445 CTGTCAAAGGAGGCGAAGGAGGG + Intronic
1182277684 22:29200825-29200847 CTTTCATAGAAGGAGACAGATGG - Intergenic
1182554123 22:31119827-31119849 CTGTGAAAGGATGAGAAATTTGG - Intronic
1182864092 22:33586820-33586842 CTGTGAAAGGAGCAGAGGGAGGG - Intronic
1183086569 22:35490678-35490700 CTGGGAAAGGAGGGGACAGCAGG - Intergenic
1183387826 22:37525235-37525257 CTGTGCCAGGAGGTGAGAGATGG + Intergenic
1183422442 22:37719806-37719828 GTGTGCAGGGAGAAGACAGAAGG - Intronic
1183543410 22:38442984-38443006 CTGTGAGAGGCTGAGACAGGAGG - Intronic
1183792414 22:40083501-40083523 CTGTGAAGGGAGCAGAAAAATGG + Intronic
1184051998 22:42014023-42014045 CTTTGAAAGGCAGAGGCAGATGG - Intronic
1184168624 22:42745326-42745348 CTGGGAAAGGGTGAGTCAGAGGG - Intergenic
1184255001 22:43281570-43281592 CTGAGAAGGGAGGTGACAGGAGG - Intronic
1184818065 22:46887135-46887157 ATCAGAAAGGAGGAGGCAGATGG + Intronic
1184902128 22:47452981-47453003 ATGTGGAAGGAGGAGCCAAATGG - Intergenic
1184996966 22:48214429-48214451 CCGTGATAGGAGGAGAATGATGG + Intergenic
1203245393 22_KI270733v1_random:63994-64016 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
949127955 3:469118-469140 GTGTGAAAGAGGGAGAGAGATGG - Intergenic
949389444 3:3543010-3543032 CTGTGAAATGAGGATACAGATGG - Intergenic
949831540 3:8220000-8220022 AGGTGAAGGGAGGAGACACAGGG + Intergenic
949996427 3:9620833-9620855 CAGAGAAAAAAGGAGACAGAAGG - Intergenic
950417913 3:12878994-12879016 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
950555927 3:13696013-13696035 CTGGGAAAGGAGGGGACATGGGG + Intergenic
950640376 3:14344665-14344687 CTGAGAAAGGGGGAGACACTGGG + Intergenic
950646458 3:14380095-14380117 CTGTGAGAGGCAGAGACAGGTGG - Intergenic
950708193 3:14796760-14796782 CTGAGAAAGGAGGAGGGAGCTGG - Intergenic
951482013 3:23171005-23171027 CTGAGAAAGGCTGAGAAAGAAGG + Intergenic
951567229 3:24023333-24023355 CAGTGATGGGAGGGGACAGACGG + Intergenic
952405024 3:32997792-32997814 CTGGGAAAGGAGAACAAAGAAGG - Intronic
952853612 3:37749628-37749650 CTGAGAAATGAGGAAAAAGATGG - Intronic
952862423 3:37824491-37824513 CTGTCACAGGATGAGACAGGGGG - Intergenic
952887818 3:38022302-38022324 CTGAGACAAGAGGAGGCAGAAGG + Intronic
953052068 3:39353658-39353680 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
953162379 3:40433250-40433272 CTTTGAAAGGCTGAGGCAGATGG + Intergenic
953268090 3:41412802-41412824 CTTTGAGAGGATGAGACAGGTGG - Intronic
953538011 3:43790492-43790514 TTGTGAAGGGAGGACACAGAGGG - Intergenic
953579164 3:44137780-44137802 CTGTAAAATGAGGATACTGATGG - Intergenic
953650499 3:44798645-44798667 CTTTGAAAGGATGAGGCAGGAGG - Intronic
953755931 3:45645848-45645870 TGGTGAAAGGAGGAGAGAGGAGG - Intronic
953854701 3:46492319-46492341 CTGTGAAAGGAAGAGCAAGGAGG + Intergenic
953892554 3:46764138-46764160 CTGTGCAAAGAGGAGAGAAAGGG + Intronic
954173752 3:48826384-48826406 CAGTGAAATGAAGAGACATACGG + Intronic
954402952 3:50328547-50328569 CTGTGAAAATAGAAGCCAGATGG - Intergenic
954904050 3:54044504-54044526 CTGTGAAAGTAGGTTACAGAAGG + Intergenic
955060994 3:55491258-55491280 CTGGGAAATGAGCAGACAGTTGG + Intergenic
955805154 3:62726022-62726044 CTGAGAAGGGAGGAGGCTGACGG + Intronic
955897061 3:63711694-63711716 ATGTGAAAGATGAAGACAGAAGG - Intergenic
956874553 3:73449170-73449192 AAATGAAAAGAGGAGACAGAAGG + Intronic
956977090 3:74593971-74593993 CTTTGAATGGAGGCCACAGAGGG + Intergenic
957686713 3:83511731-83511753 CTTTGAAAGGCTGAGACAGAAGG - Intergenic
958115009 3:89203945-89203967 CTGGGTAAAGCGGAGACAGAAGG + Intronic
958122512 3:89309838-89309860 TTGTGAAAAGAGAAGAAAGAAGG - Intronic
960350378 3:116585734-116585756 CTGGGAGAGGAGGAAAAAGAAGG + Intronic
960615833 3:119595336-119595358 CATTGTAAGGTGGAGACAGATGG - Intergenic
960718166 3:120598295-120598317 CTCTGAGAGGCGGAGACAGGAGG - Intronic
961323822 3:126097926-126097948 CTGTGTAAGGGGGAGACAGAGGG - Intronic
962008101 3:131368495-131368517 TAGAGGAAGGAGGAGACAGAGGG + Intergenic
962189148 3:133291810-133291832 CTGAGAAAGGCCGAGATAGATGG - Intronic
962712177 3:138097442-138097464 CTGTGAATGGGGCAGTCAGATGG - Intronic
963729625 3:148958743-148958765 CAATGAAAGGAGGAGCCATATGG + Intergenic
964280725 3:155061501-155061523 CTGGGACAGGAAGTGACAGAGGG + Intronic
964365692 3:155949003-155949025 CTTTGTAAGGCCGAGACAGAAGG + Intergenic
964635729 3:158856812-158856834 CTGTGTAAGGAGGCTAAAGATGG + Intergenic
964828495 3:160856622-160856644 CTGAGAAAGGAGCAGACACTGGG + Intronic
964908449 3:161747975-161747997 CTGTGAGAGGTGGAGTCAGGAGG + Intergenic
965173819 3:165303469-165303491 TTATGAAAGGAGTTGACAGATGG + Intergenic
965929821 3:174029217-174029239 CTGTGAAAGGAGCTGAGAGGTGG + Intronic
965935194 3:174100741-174100763 CTTAGAAAGCAGGAGGCAGAAGG - Intronic
966175469 3:177133656-177133678 CTTTGAGAGGCGGAGGCAGATGG + Intronic
966190197 3:177265469-177265491 CTTTGAAAGGCTGAGACAGGAGG - Intergenic
966889017 3:184392810-184392832 CTTTGGGAGGCGGAGACAGATGG + Intronic
967695326 3:192524491-192524513 GTGGGAAAGGAGGAGAAAAAGGG + Intronic
967913366 3:194559981-194560003 CTATGGAAGGTGGAGACTGAGGG - Intergenic
967953951 3:194862871-194862893 CTGGGAGAGGAGGAGGCAGAGGG - Intergenic
968042277 3:195598812-195598834 GTGTGAGGGGTGGAGACAGAGGG - Intergenic
968378822 4:70579-70601 CTCTGAAAGGCTGAGACAGGTGG - Intronic
968638718 4:1698116-1698138 CTGTGGGAGGCAGAGACAGACGG + Intronic
968828364 4:2916002-2916024 CTGTGATGAGAGGAGACAGCAGG + Intronic
969043076 4:4316254-4316276 CTGGGAAAGTAGGGGACAGCAGG + Intronic
969123222 4:4924839-4924861 CTCTTAAAGAAGGAGACACACGG - Intergenic
969442675 4:7226637-7226659 CTATGAAAGCTGGGGACAGATGG - Intronic
969557353 4:7921426-7921448 CTTTGAGAGGCGGAGACAGGCGG - Intronic
969676204 4:8615692-8615714 CAGCCAGAGGAGGAGACAGAGGG + Intronic
970251241 4:14118187-14118209 CTGTGAAAGAAGAAGACTAAAGG + Intergenic
970251873 4:14125377-14125399 TTCTGAAAGGGGGAGAGAGATGG - Intergenic
971582296 4:28357280-28357302 ATGGGAAAGGAGGAGAGGGAAGG + Intergenic
971970975 4:33620027-33620049 TTGTGGAAGAAGCAGACAGAGGG + Intergenic
973719418 4:53708078-53708100 TTTTGAAAGGAGAAGTCAGAAGG + Intronic
973749221 4:53996170-53996192 CTTTGAGAGGCTGAGACAGAAGG - Intronic
973772411 4:54218966-54218988 CTTTGGACAGAGGAGACAGACGG - Intronic
974132809 4:57777457-57777479 CTGGGAAAGAAGGAGGCTGAGGG - Intergenic
974140565 4:57881093-57881115 GTGTGAAATGGGGAGAAAGAGGG - Intergenic
974984793 4:69009623-69009645 CTGTAGAAATAGGAGACAGAGGG + Intronic
975145217 4:70959455-70959477 CCGTGAAAGGCTGAGATAGAAGG - Intronic
975641582 4:76505892-76505914 CTTTGGGAGGAGGAGGCAGAAGG - Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975798958 4:78038676-78038698 CTGGGAAAGGTGGAGTAAGAAGG + Intergenic
977076165 4:92453219-92453241 CTGGGAAAGGAGGGGAGAGAAGG + Intronic
977278461 4:95008944-95008966 CTTTGGAAGGCTGAGACAGAAGG + Intronic
977333124 4:95662910-95662932 CTTTGGAAGGCGGAGACAGGGGG - Intergenic
977534823 4:98244904-98244926 ATGGGAAAGGAGCAGACTGAGGG + Intergenic
978792334 4:112675814-112675836 CTGTAAAAGAAGGATGCAGATGG - Intergenic
979056807 4:116005749-116005771 ATGTGATAGATGGAGACAGATGG - Intergenic
979099279 4:116595225-116595247 ATGTCAAAGGAGGAGAGAAATGG + Intergenic
979590348 4:122471885-122471907 AAGTGAAAGGAGGAGTCACATGG + Intergenic
980478537 4:133354154-133354176 CTGTGAAAGGAACATACATAAGG + Intergenic
981403098 4:144337398-144337420 CTGCCAAATGAGGAGACAGGAGG - Intergenic
981683457 4:147426700-147426722 CTGTCAAAGGCTGAGATAGATGG + Intergenic
982111186 4:152056238-152056260 CTTTGGGAGGACGAGACAGATGG - Intergenic
982989893 4:162259640-162259662 TTGGAAAAAGAGGAGACAGAAGG + Intergenic
983564868 4:169139183-169139205 CTTTGAAAGGCTGAGACAGGAGG - Intronic
983599202 4:169505316-169505338 CTGAGGAAGGAGGAGTAAGAGGG - Intronic
983754314 4:171315005-171315027 TTGGGAAAGGAAGAAACAGATGG + Intergenic
984469410 4:180147805-180147827 CTGTGAGAGGAGGATGCAGAAGG - Intergenic
985645031 5:1080737-1080759 CTGTTTGAGGAGGACACAGAGGG + Intronic
986035593 5:3933955-3933977 CTGAGAAAGGAGGGGTAAGAGGG + Intergenic
986226041 5:5813623-5813645 CTTTTTAGGGAGGAGACAGATGG - Intergenic
986615748 5:9615546-9615568 ATGAGAGAGGAAGAGACAGATGG + Intergenic
986617048 5:9628448-9628470 CTGATAAAGGGGAAGACAGATGG - Intergenic
986761963 5:10888371-10888393 CTGAGAAATCAGGAGAGAGATGG - Intergenic
987278740 5:16390226-16390248 CAGTGAGAGGTGGAGACAGATGG + Intergenic
987853737 5:23390712-23390734 GGGAGAAAGCAGGAGACAGAAGG + Intergenic
989806547 5:45614295-45614317 CTAGGAAATTAGGAGACAGACGG - Intronic
990700649 5:58471877-58471899 GTGAGAAAGGAGGAGAAATAAGG - Intergenic
992102426 5:73419953-73419975 CCGTGAAAGGAGGGGAGCGAGGG + Intergenic
992341071 5:75823945-75823967 CTGTGGGAGGAGGAGGCAGAAGG + Intergenic
992640443 5:78764260-78764282 CTGTGAAAGCAGGAGCCAGGTGG - Intronic
992805221 5:80330906-80330928 CTTTGAGAGGCCGAGACAGATGG + Intergenic
993374428 5:87133511-87133533 CTTTGAAAGGCCGAGACAGGAGG - Intergenic
993783910 5:92105016-92105038 CTGTGAAAAGAGGGGAGAGTGGG + Intergenic
993954599 5:94216516-94216538 CTGTGATAAGAGGGGACAAAAGG + Intronic
996083281 5:119278417-119278439 GTGTGAAGGGTGGACACAGAGGG + Intronic
996743802 5:126827822-126827844 CTGTGAAAGGAGTGGTCAGCGGG + Intronic
996929802 5:128872035-128872057 TTGAGAAAGGAAGGGACAGATGG - Intronic
997001193 5:129764197-129764219 CTGTGAAAGAAAGAGAGACATGG + Intronic
997295211 5:132764613-132764635 CTGTGGAAGGAAGAGCCAAAAGG + Intronic
998260000 5:140623204-140623226 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
998557503 5:143139875-143139897 CTGTAGAAGGGGGAGCCAGAAGG + Intronic
998936705 5:147236647-147236669 CTGTGGAAGGGGGAAGCAGATGG - Intronic
998993814 5:147848691-147848713 CTGTGAACGAAGGAAACAAATGG - Intergenic
999102410 5:149037410-149037432 TGGGGAGAGGAGGAGACAGAAGG - Intronic
999452246 5:151687016-151687038 CGGGGGAAGGAGGAGACAGGAGG - Exonic
999463428 5:151777067-151777089 TTGTGAAGGGAGGTGACAGGTGG + Intronic
999835255 5:155363553-155363575 ATGGGGAAGGAGGAGAAAGATGG - Intergenic
999854392 5:155578071-155578093 CTGTGAAAGTAGGGAACAGCTGG + Intergenic
999907295 5:156155906-156155928 CTGAGATAAGAGGAAACAGAAGG + Intronic
1000122840 5:158213980-158214002 CTGTAGAAGAAAGAGACAGACGG - Intergenic
1000429544 5:161135093-161135115 CTTTGAGAGGCCGAGACAGATGG + Intergenic
1001087649 5:168712680-168712702 CTGAGAAAGGAAGAGACCCAAGG + Intronic
1001600402 5:172924526-172924548 CTGAGGAAGGTGGAGACTGAAGG + Intronic
1001902189 5:175441877-175441899 CTGAAAAAGGAGGAGGCAGCTGG - Exonic
1002163277 5:177329681-177329703 CTTTGGCAGGAGGAGACAGAGGG + Intergenic
1002701660 5:181128982-181129004 CTTTGAAAGGCTGAGGCAGAAGG + Intergenic
1002704313 5:181149862-181149884 GAGTGAAAGGAAGAGAGAGATGG + Intergenic
1003099530 6:3166509-3166531 ATGTGAAAGGAGGAGGTAGAAGG - Intergenic
1003120079 6:3312278-3312300 GAGTGAAAGGTGCAGACAGAGGG - Intronic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003587657 6:7407735-7407757 CTTTGAGAGGCCGAGACAGAAGG - Intronic
1003898172 6:10627874-10627896 GGGAGAAAGGAGGAGACAGAGGG + Exonic
1003985596 6:11431550-11431572 CTTTGGAAGGAGGTGACACAGGG - Intergenic
1004010550 6:11681915-11681937 CTGGGAAAGGGAGAGAAAGAGGG + Intergenic
1004640378 6:17509432-17509454 CTGTGGAAGGCTGAGACAGGTGG + Intronic
1005330923 6:24749380-24749402 GTGAGAAAGAAAGAGACAGATGG + Intergenic
1006364297 6:33606263-33606285 CTGTGGGAGGCTGAGACAGATGG + Intergenic
1006389432 6:33749805-33749827 CTGTGAAATGAGGGGAATGATGG - Intergenic
1006389802 6:33751675-33751697 CTGTGAAATGAGGGGAATGATGG - Intergenic
1006547306 6:34790853-34790875 CTTTGAGAGGCCGAGACAGACGG - Intergenic
1006644692 6:35508062-35508084 CTTTGGGAGGAGGAGGCAGATGG - Intronic
1006752953 6:36390685-36390707 CTTTTAAAGGAGGGGAGAGAGGG + Exonic
1006896852 6:37476690-37476712 CAGAGTCAGGAGGAGACAGATGG + Intronic
1007149300 6:39672223-39672245 CTTTGGAAGGCTGAGACAGAAGG - Intronic
1007380283 6:41485794-41485816 CACTGGAAGGAGGTGACAGACGG - Intergenic
1007989748 6:46243048-46243070 AAGTGACAGGAGGAGACTGAAGG + Intronic
1008742779 6:54629962-54629984 CTTTGAAAGGCGGAGACAGGTGG + Intergenic
1008893652 6:56526136-56526158 CTGTGAAACAATGAGGCAGATGG + Intronic
1009783775 6:68303979-68304001 CAGTGAAAGCAGTAAACAGAGGG + Intergenic
1010627844 6:78160400-78160422 CTGGGAAAAGAGGAGAGACAAGG - Intergenic
1011229271 6:85141654-85141676 CTGCCAAAGGAGGAAATAGAAGG - Intergenic
1011490130 6:87883137-87883159 CTATAAAAGGAGGAGACAAAGGG - Intergenic
1012638649 6:101580700-101580722 CTGAGAAAGGAAGAGAAAGATGG - Intronic
1012670294 6:102036567-102036589 ATGTGAAAGAAGTAGAGAGAGGG + Intronic
1012707782 6:102555027-102555049 GAGTGAAAGAAGGAGAGAGAGGG + Intergenic
1012954762 6:105557655-105557677 CTTTGGAAGGATGAGACAGGAGG - Intergenic
1013094045 6:106928083-106928105 GTGAGAAAGGAGGAAACAAACGG + Intergenic
1013166809 6:107601623-107601645 CAGAGAGAGGAAGAGACAGAAGG - Intronic
1013312861 6:108913886-108913908 TTGTTAAATGAGGAGAGAGAAGG - Intronic
1013410042 6:109876075-109876097 CTTGGAGAGGAGGAGCCAGAGGG + Intergenic
1013410322 6:109877799-109877821 CTAGGAAAGGAGGAGAGACAAGG - Intergenic
1013559468 6:111290106-111290128 CTGGGAAACGAGGTGACTGATGG - Intergenic
1013588361 6:111599149-111599171 CTTTGGAAGGACGAGGCAGAAGG - Intronic
1014311719 6:119812097-119812119 CTGTGACTGGAGAAGACAGGAGG - Intergenic
1014682388 6:124447863-124447885 CAGAGAAAGGTGAAGACAGAGGG - Intronic
1015041687 6:128728158-128728180 CAGAGAAAAGAGGAGAGAGATGG - Intergenic
1015062017 6:128977503-128977525 CTTTGAAAGGCTGAGGCAGAAGG - Intronic
1015323267 6:131899686-131899708 CTGGCAAAGGTGGAGACACAGGG + Intergenic
1015370005 6:132439879-132439901 CTTTGAAAGGACTAGACACAGGG - Intergenic
1015845010 6:137511144-137511166 AGAAGAAAGGAGGAGACAGAAGG + Intergenic
1016857227 6:148683350-148683372 CTGTGTAAACAGGAGACAGATGG - Intergenic
1017081495 6:150673663-150673685 CTGAAAAAGGAGGAGAGGGAGGG - Intronic
1017438736 6:154442772-154442794 CTGTGGAAGGAGCAGAGAGAAGG - Intronic
1017548376 6:155476705-155476727 CTTTGAAAGGCTGAGGCAGAAGG + Intergenic
1017567250 6:155700800-155700822 CTTTGAAAGGCTGAGGCAGAAGG - Intergenic
1017683801 6:156891227-156891249 CTGTGAAATCAGGAGCCAGCAGG + Intronic
1017693650 6:156992557-156992579 CCGGGAATGGAGGGGACAGACGG + Intronic
1018742663 6:166742513-166742535 TTGTGTCAGGAGGAGGCAGAAGG - Intronic
1019210760 6:170402641-170402663 CAGAAAAAGGAGGAGACAGTTGG + Intronic
1019299881 7:297559-297581 CTGTGAGGGGAAGAGATAGATGG + Intergenic
1020084855 7:5304745-5304767 CTTTGGGAGGATGAGACAGATGG - Exonic
1020290493 7:6718933-6718955 CTTTGAGAGGTGGAGACAGGAGG + Intergenic
1020660490 7:10974956-10974978 CTGGGAAAGGGGAAGAGAGAAGG - Intronic
1021049408 7:15964256-15964278 CTGTCAAAGGAGAAAAGAGATGG + Intergenic
1021878929 7:25075348-25075370 CAGTGAAAAGAAGAGACACATGG + Intergenic
1022050954 7:26671043-26671065 CTGTCAAAGGAGGAAAAAGTGGG - Intronic
1022137559 7:27463607-27463629 CTGTGATAAATGGAGACAGAAGG - Intergenic
1022283973 7:28937768-28937790 CTGGGAACTGAGGACACAGAAGG - Intergenic
1022314588 7:29233631-29233653 ATGTGAAAGAGGGAGACAGAAGG + Intronic
1022454846 7:30549411-30549433 CTGTAAAATGAGGAGAATGATGG + Intronic
1023376733 7:39563694-39563716 CTTTGAAAGGCTGAGGCAGAAGG + Intergenic
1023659789 7:42459965-42459987 CTTTGAAAGGGTGAGGCAGAAGG - Intergenic
1024192007 7:47021777-47021799 CGGTGATAGTAGAAGACAGAGGG + Intergenic
1024193074 7:47032318-47032340 AAGTGAAGGGAGAAGACAGAAGG - Intergenic
1024256594 7:47544292-47544314 TTGTGAGAGGTGGAGACAGGTGG - Intronic
1024497288 7:50063169-50063191 CTGGGAAGGGAGGAGAGATAAGG + Intronic
1024498155 7:50070916-50070938 CTGGGAAAGGGGGAGAGATAAGG + Intronic
1025776354 7:64564121-64564143 CTTTGGGAGGATGAGACAGAAGG - Intergenic
1025930813 7:65992514-65992536 CTGGGAAAGGAGGAGTGATAAGG - Intergenic
1026269601 7:68824617-68824639 CTGGGAAGGGAGGAGAGATAAGG + Intergenic
1026396379 7:69958567-69958589 TAGTGTAAGGAGGAGACAAAGGG + Intronic
1026473032 7:70710397-70710419 CTGTGACAGCTGAAGACAGATGG - Intronic
1026725466 7:72866971-72866993 CTTTGAGAGGTGGAGACAGGAGG + Intergenic
1026989538 7:74575922-74575944 CTCTGGAAGGCTGAGACAGAAGG + Intronic
1027957600 7:84900971-84900993 ATGTGGAAGGAGGGGAAAGAGGG + Intergenic
1028299923 7:89185615-89185637 CTTTGAAAGGACGAGGCAGGTGG + Intronic
1029226705 7:99033898-99033920 CTGGGAAAGGAGGGCGCAGAGGG + Intronic
1029328766 7:99833505-99833527 CTGGGAAGGGAGGAGAGATAAGG + Intronic
1029481940 7:100818645-100818667 CTGTGAGAGGCAGAGACACAGGG + Intronic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1030625544 7:111842185-111842207 CTCTGACAGGAGGGGAGAGAGGG + Intronic
1031098304 7:117447618-117447640 CTGTGAAAAGCCGAGGCAGAAGG - Intergenic
1031630201 7:124034481-124034503 CGGGGGAAGGAGGAGAAAGAGGG - Intergenic
1032385610 7:131521233-131521255 CCCTGAAAAGTGGAGACAGATGG + Intronic
1032443130 7:131957662-131957684 CTGTAAAAGGAGGGGACTGTAGG + Intergenic
1033280724 7:140004719-140004741 CTGTGGAAAGGGGAGACAGCTGG - Intronic
1034836854 7:154360356-154360378 CTGTGAAAGGAAGAAATTGAAGG - Intronic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035681708 8:1493281-1493303 CTGTGGACGGAGGGCACAGACGG + Intergenic
1035753515 8:2012305-2012327 CAGTGACAGGAGGAGAGGGAAGG + Intergenic
1035813803 8:2516991-2517013 CTGTGAAATGAAGACATAGAGGG - Intergenic
1036078562 8:5527318-5527340 ATTTGAATGGAGGAGGCAGAAGG + Intergenic
1036172539 8:6503262-6503284 CTGTGAAAGTAAAACACAGAAGG + Intronic
1036811781 8:11871967-11871989 CTTTGAGAGGCGGAGACAGCAGG - Intergenic
1036973613 8:13383277-13383299 CAATAAAAGGAGGAAACAGAAGG - Intronic
1037049131 8:14347958-14347980 GTGGGAAAGGAAGAGAAAGAGGG - Intronic
1037116786 8:15237213-15237235 CTGGGAAAGCAGGCGACAGCGGG + Intronic
1037149366 8:15617029-15617051 CTGTGTAATCAGCAGACAGAGGG + Intronic
1037609854 8:20466816-20466838 CTGTGAAAAGAAGACACAGCGGG - Intergenic
1038085681 8:24193701-24193723 ATGAAAAAGGAGGAGATAGATGG + Intergenic
1038407145 8:27330618-27330640 CTGTGCAAGGGGGCGGCAGAGGG + Intronic
1038670263 8:29577412-29577434 CTGGGCAAGGAGGGGAAAGAAGG - Intergenic
1038817944 8:30925574-30925596 CTGGGAAAGGAGGCGACATAAGG - Intergenic
1039182818 8:34885418-34885440 CTGTTGAATGAGGAGACAGGAGG - Intergenic
1039666380 8:39535602-39535624 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1039765929 8:40627872-40627894 CTGTGAAGGCAGGAGCCTGAGGG + Intronic
1040095128 8:43435403-43435425 CTGTGAAAGGAGGCTATAGGAGG + Intergenic
1040900510 8:52412952-52412974 TTTTTAAAGGAGGAGAGAGATGG - Intronic
1041313520 8:56539505-56539527 GAGAGAAAGGAGGAGACTGAGGG + Intergenic
1042264479 8:66894015-66894037 CTGTGAGTAGAGGAGACACATGG + Intronic
1042290210 8:67163052-67163074 CAGTGAAAGGAATGGACAGAGGG + Intronic
1042734049 8:71968028-71968050 TTGTGAAAGTAGGAGAGAGAAGG + Intronic
1042819835 8:72917941-72917963 GTGTGAAAGGTGTAGAGAGAAGG + Intronic
1042917143 8:73886695-73886717 CTTTGAAAGGCTGAGACAGGAGG + Intergenic
1044068204 8:87723663-87723685 GAGAGAAAGGAGGAGAGAGAGGG + Intergenic
1045001285 8:97880415-97880437 CTGGGAGAGGAGGAGAGATAAGG - Intronic
1046359126 8:113127489-113127511 GAGGGAAAGTAGGAGACAGAGGG - Intronic
1046366620 8:113240155-113240177 CTTTGAAAGGAGGACATGGATGG - Intronic
1046507314 8:115152668-115152690 ATGTGGACAGAGGAGACAGATGG + Intergenic
1046508431 8:115166400-115166422 ATGTCACAGGAAGAGACAGAAGG + Intergenic
1047283329 8:123464663-123464685 CTGTGGCAGCAGGACACAGAGGG + Intronic
1047967284 8:130055601-130055623 CTGTGAAAGTTTGAGACTGATGG + Intronic
1048217833 8:132512785-132512807 CTGTTCAGGCAGGAGACAGATGG - Intergenic
1048591604 8:135825750-135825772 CTATGGAGGGAGGAGAAAGATGG - Intergenic
1049170796 8:141159406-141159428 ATGTGACAGGAAGACACAGACGG - Intronic
1049239581 8:141530419-141530441 CTGTGAAAGGAAGAGACGGGTGG - Intergenic
1049297828 8:141852525-141852547 CCGTGGAAGCAGGAGACAGGAGG + Intergenic
1049468823 8:142766115-142766137 CTGGGAAAGGAGGAGAGAGAAGG - Intronic
1049848518 8:144817867-144817889 ATGTCAAATGAAGAGACAGATGG - Intergenic
1050297777 9:4223479-4223501 CTCTAAAAGGAGGAGGCAGTGGG - Intronic
1051278355 9:15418090-15418112 CAAGGAAGGGAGGAGACAGAAGG - Intergenic
1051345183 9:16144971-16144993 CAGTGAAAGGAGGAGGCTGATGG - Intergenic
1051902914 9:22062096-22062118 CTGTGAAGGGAAGATACAGGTGG + Intergenic
1052161385 9:25264221-25264243 TTTTGAAAGGATGAAACAGAAGG - Intergenic
1052856269 9:33408452-33408474 CTGAGAGAGGTGGAGGCAGAGGG - Intergenic
1053847821 9:42258654-42258676 CTTTGAGAGGCGGAGACAGGCGG + Intergenic
1055496975 9:76865247-76865269 CTGTGAAAGGCTGAGGCAGGAGG + Intronic
1055917605 9:81421647-81421669 CAGTAAAATCAGGAGACAGAGGG + Intergenic
1056286414 9:85091845-85091867 CTGTGAAGGGAAGAGAAAGATGG + Intergenic
1056368346 9:85929076-85929098 CTTTGAAAGTACGAGACAGATGG + Intergenic
1056981406 9:91315237-91315259 CTGTCAAAAGATGAAACAGAGGG - Intronic
1056989888 9:91400885-91400907 CTTTGAAAGGACAAGGCAGAAGG - Intergenic
1057345444 9:94246747-94246769 CTGTGGAAGGAGGAGGGATAAGG - Intergenic
1057477963 9:95420676-95420698 CTGTGACAGAAGGAGAGGGAGGG - Intergenic
1058110837 9:101029363-101029385 CTGGGAAACGTGGAGACAAAGGG + Intronic
1058246568 9:102633044-102633066 CTGTGAAAGGAATAGACAGTAGG - Intergenic
1058661866 9:107274038-107274060 GCGAGAAAGAAGGAGACAGAAGG + Intergenic
1058682032 9:107448589-107448611 CTTTGAAAGGTTGAGGCAGAAGG + Intergenic
1059246405 9:112853265-112853287 CTGTGGCAGGAGGAACCAGAGGG - Intronic
1059456430 9:114402935-114402957 CTCTGCAGGGAGGAGACACAGGG + Exonic
1059632468 9:116139362-116139384 CGGTGGAGGGATGAGACAGAAGG - Intergenic
1060477484 9:123997367-123997389 CTCTGTAAGGAGGAGGCAAAGGG - Intergenic
1060715965 9:125929051-125929073 CTTTGAAAGGTGGATAAAGATGG - Intronic
1061047686 9:128175960-128175982 CAATGAAAGGGGGAGACACAGGG + Intronic
1061081461 9:128373197-128373219 CTGTGACAGGAGGTGATAGAAGG - Intronic
1061190216 9:129078561-129078583 CTGTTAATGGTGGGGACAGAGGG - Intergenic
1061328466 9:129878303-129878325 CAGGGACGGGAGGAGACAGAGGG - Intronic
1061528956 9:131194850-131194872 CTGTTAAGTGAGGGGACAGAAGG - Intronic
1062122684 9:134842134-134842156 CTGGGGAAGAGGGAGACAGATGG - Intronic
1062396864 9:136356106-136356128 GGGTGACAGGAGGAGACAGGAGG - Intronic
1203461730 Un_GL000220v1:47066-47088 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1185553640 X:1003344-1003366 GTGTGGCAGGAGGAGAGAGAAGG + Intergenic
1185618153 X:1435759-1435781 CTGTGAGAGGAAGGGACAGAGGG + Intronic
1186140665 X:6568477-6568499 CTGTGTTAGGAGGAGAAAGCAGG + Intergenic
1187254504 X:17629988-17630010 CTGTCAAGGGAGAAGAGAGAGGG + Intronic
1187699717 X:21953478-21953500 CTGGGAAAGGAGGAGAGATAAGG + Intronic
1187946718 X:24433383-24433405 CTAGGAAAGGAGGAGAGATAAGG + Intergenic
1188197276 X:27251926-27251948 CTCTGAAAGGTGGAAAGAGAAGG - Intergenic
1189463287 X:41259548-41259570 CTTTGAGAGGCGGAGGCAGAAGG - Intergenic
1189734600 X:44056986-44057008 GAGAGAAAGGAGGAGAAAGATGG - Intergenic
1190357032 X:49615380-49615402 GAGTGAAAGAGGGAGACAGAAGG - Intergenic
1191036641 X:56031679-56031701 CTGGGAAACGAGGTGACTGATGG - Intergenic
1192966035 X:76177838-76177860 CTGACAAAGGAGGAGAAAAAGGG + Exonic
1194605745 X:95975848-95975870 CTGTGAGAGGTGGAGCAAGATGG + Intergenic
1196505017 X:116431710-116431732 CTGTGGCAGGAAAAGACAGAAGG - Intergenic
1196867120 X:120080238-120080260 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1196874626 X:120146541-120146563 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1196875979 X:120156044-120156066 CTGGGAAAGGAGGAGAGATAAGG - Intergenic
1196883904 X:120224602-120224624 CTGGGAAGGGAGGAGAGATAAGG + Intergenic
1196928705 X:120660065-120660087 GTGTAAAAGGAGGAGAGAGAGGG + Intergenic
1197360164 X:125491798-125491820 CTTTGGAAGGCCGAGACAGATGG + Intergenic
1197770838 X:130088265-130088287 CTGTGAGTGGAGGAGATGGAGGG + Intronic
1197882530 X:131181972-131181994 ATGTGAAAGAAGGACACAAACGG - Intergenic
1198925902 X:141795063-141795085 CTGTGAAAGGAAGATTCAGTGGG - Intergenic
1199323154 X:146464588-146464610 CTGTTTAAGGAGGATAAAGATGG + Intergenic
1199571557 X:149271803-149271825 AAGTGAAAGGAGGTGAAAGAAGG - Intergenic
1199833553 X:151566389-151566411 CTCTGGAAGGAGAAGGCAGAGGG + Intronic
1199849869 X:151717840-151717862 CTCTGAGAGGAGGAGGCGGACGG + Intronic
1199904955 X:152216635-152216657 CTGGGGAAGGAGAAGAGAGAGGG + Intronic
1200156835 X:153981264-153981286 CTGTGACTGAAGGAGACAGAAGG + Intronic
1200319622 X:155173725-155173747 CTGGGAAAGGAGGAGAGATAAGG + Intergenic
1201644441 Y:16213732-16213754 CTGGGAAAGTAGGAGAGATAAGG + Intergenic
1201658374 Y:16371589-16371611 CTGGGAAAGTAGGAGAGATAAGG - Intergenic
1202070737 Y:20989449-20989471 CTGGGAAAAGAGGAGAAATAAGG - Intergenic
1202305015 Y:23459919-23459941 CTTTGGGAGGCGGAGACAGAAGG + Intergenic
1202565795 Y:26210671-26210693 CTTTGGGAGGCGGAGACAGAAGG - Intergenic