ID: 1089281178

View in Genome Browser
Species Human (GRCh38)
Location 11:117375704-117375726
Sequence GGCTGCGAAAACCGAAGTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089281178_1089281185 26 Left 1089281178 11:117375704-117375726 CCAGGACTTCGGTTTTCGCAGCC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1089281185 11:117375753-117375775 GATGTGCTTTCCCCAGTCCTGGG 0: 1
1: 0
2: 0
3: 22
4: 211
1089281178_1089281186 29 Left 1089281178 11:117375704-117375726 CCAGGACTTCGGTTTTCGCAGCC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1089281186 11:117375756-117375778 GTGCTTTCCCCAGTCCTGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 210
1089281178_1089281182 -2 Left 1089281178 11:117375704-117375726 CCAGGACTTCGGTTTTCGCAGCC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1089281182 11:117375725-117375747 CCGGATCTCGGAGCACCTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 72
1089281178_1089281184 25 Left 1089281178 11:117375704-117375726 CCAGGACTTCGGTTTTCGCAGCC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1089281184 11:117375752-117375774 TGATGTGCTTTCCCCAGTCCTGG 0: 1
1: 0
2: 0
3: 23
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089281178 Original CRISPR GGCTGCGAAAACCGAAGTCC TGG (reversed) Exonic
900406823 1:2496436-2496458 GGCTGCGGAAACCTGAGTGCTGG - Intronic
901602523 1:10432989-10433011 AACTGCCAAAACCCAAGTCCAGG - Intronic
910867216 1:91799458-91799480 GGCTGGGAAAGCCGGAGGCCAGG - Intronic
914882975 1:151561945-151561967 GACTAGGAAAACTGAAGTCCAGG - Intronic
922871807 1:228908673-228908695 AGCTGCTAAAACTGAAGGCCAGG + Intergenic
1072741386 10:97912073-97912095 AGCTGAGAAAACAGAAGCCCAGG - Intronic
1076217570 10:128708607-128708629 GGCGACGAAAACCGGAGACCGGG + Intergenic
1086893554 11:92286371-92286393 GGATGTGAATGCCGAAGTCCTGG + Intergenic
1089281178 11:117375704-117375726 GGCTGCGAAAACCGAAGTCCTGG - Exonic
1092669928 12:10851448-10851470 GGCTGAGGAAACTGCAGTCCTGG + Intronic
1098200774 12:68052981-68053003 GCCTGAGAAAACCAAAGCCCTGG - Intergenic
1112507259 13:99982412-99982434 GGCTGCGGAACAGGAAGTCCCGG - Exonic
1113131911 13:107046345-107046367 GGCTGAGAAATCCAAAGTCAAGG + Intergenic
1113461995 13:110488619-110488641 GGCTGCCCAAACTGAAATCCCGG + Intronic
1113708842 13:112451449-112451471 GGCAGCAAAACCCGAAATCCCGG + Intergenic
1114571474 14:23672254-23672276 GGCTGAGGACACCGAAATCCTGG + Intergenic
1115619058 14:35122777-35122799 AGCGGCGAAAGCCGAAGTCTAGG - Intronic
1119264107 14:73254035-73254057 TGCTGTGGAAACCGAGGTCCTGG + Intronic
1129195020 15:73959082-73959104 GGCTGTGAATACAGAAGTCCTGG + Intergenic
1136851840 16:33618434-33618456 GGATGAGAAAACCGAGGCCCAGG - Intergenic
1141126206 16:81402885-81402907 AGATGAGAAAACTGAAGTCCTGG - Intergenic
1143450438 17:7033462-7033484 GGCTGAGAAATCCAAGGTCCAGG + Intergenic
1143473758 17:7191777-7191799 GGCTGCTGAAACCGCTGTCCAGG + Intronic
1146867352 17:36349159-36349181 GGCTGGGAAAACCAAAATCAAGG + Intronic
1151286379 17:73114496-73114518 GGCTGAGAAAACCAAGGTCAAGG - Intergenic
1151760314 17:76097967-76097989 GGCTGCGAAATTCGGACTCCAGG + Exonic
1152597041 17:81242825-81242847 GGCTGCGAAGCCCGAGATCCAGG + Intergenic
1163262639 19:16200360-16200382 GGCTGCCAAGCCAGAAGTCCTGG + Intronic
1168271944 19:55254859-55254881 GGCTGGGAACACCCAATTCCAGG + Intronic
925516499 2:4689383-4689405 GGCTGAGAAATCCAAAGTCAAGG - Intergenic
926606478 2:14903791-14903813 AGCTGAGAAAATCGAAGTTCAGG + Intergenic
927484088 2:23477162-23477184 GGCTGAGAATACAGCAGTCCCGG - Intronic
937089742 2:119198245-119198267 GGCTGTGGACACCCAAGTCCTGG - Intergenic
939582270 2:143964823-143964845 GTCTGCGAAAACCATAGTTCAGG + Intronic
940343149 2:152601988-152602010 AGATGTGAAAACTGAAGTCCAGG + Intronic
943756590 2:191563587-191563609 GGCTGGGAAGAGCCAAGTCCAGG - Intergenic
1171190504 20:23155977-23155999 GGCTGCAAAGTCCAAAGTCCAGG - Intergenic
1173221502 20:41136549-41136571 GGCGGGGAAAACCAAAGTTCAGG + Intergenic
1173714460 20:45190216-45190238 GGATGGGAAAACCGGAATCCAGG + Intergenic
1174068687 20:47884807-47884829 GGATGAGTAAACTGAAGTCCAGG + Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
950610573 3:14124462-14124484 GGATGAGAAAACCGAAGCTCTGG - Intronic
950851009 3:16062338-16062360 AGATGAGAAAACCGAGGTCCAGG - Intergenic
956357259 3:68407702-68407724 GGCTGCCAAGACTCAAGTCCTGG - Intronic
963838750 3:150083075-150083097 AGATGAGAAAACTGAAGTCCAGG - Intergenic
969096938 4:4740264-4740286 GGCTGAGAAGTCCAAAGTCCAGG - Intergenic
979318932 4:119300586-119300608 TGCGGCGAACACCAAAGTCCGGG - Exonic
995057911 5:107781733-107781755 GGCTGTGAAAACCAAAATCCTGG - Intergenic
997226011 5:132210077-132210099 GACTGCGCAAACCTAAGGCCAGG + Intronic
999458447 5:151737339-151737361 AGGTGTGAAAACCGAGGTCCTGG + Intergenic
1012401576 6:98845901-98845923 GGGTGCGAGGACAGAAGTCCTGG - Intergenic
1030426698 7:109387555-109387577 GGCTGCAAAAACCATAGTGCAGG + Intergenic
1038726312 8:30085257-30085279 GGCTGGGAAATCCTAGGTCCAGG - Intergenic
1189944633 X:46165401-46165423 GGCAGAGAAAACTGAAGACCGGG - Intergenic