ID: 1089283910

View in Genome Browser
Species Human (GRCh38)
Location 11:117393608-117393630
Sequence ATCCTAGCTCTTCTACTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 402}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089283910 Original CRISPR ATCCTAGCTCTTCTACTTAT TGG (reversed) Intronic
901518813 1:9768087-9768109 ATCGTAGCTCTGCTACTTATTGG - Intronic
902181757 1:14694667-14694689 AGCCTGACTCTGCTACTTATAGG + Intronic
902785716 1:18731426-18731448 ATCCCAGCTCTGCCACTTACCGG + Intronic
903004342 1:20288843-20288865 ATCCCAGCTCTGCCACTTCTTGG + Intergenic
903666807 1:25013025-25013047 ATCCCAGCTCTGCCACTTACCGG - Intergenic
903780376 1:25816610-25816632 AGGCTAGCTCTTCTACCTCTGGG + Exonic
904046321 1:27611069-27611091 ATCCTTCCTCCTCTAGTTATTGG - Intergenic
904608605 1:31712878-31712900 ATCCTGGCTCTGCTACTTCCTGG + Intergenic
904705157 1:32384383-32384405 ATCCTTGCTCTACCACTTGTTGG + Intronic
906477380 1:46178774-46178796 ATCCTGGCTCTGCCACTTACAGG + Intronic
907759161 1:57340977-57340999 AACCCAGCTCTTATACTTCTTGG - Intronic
907847688 1:58224149-58224171 ATCCTTGCTCTTCCAATTATAGG + Intronic
908172924 1:61525655-61525677 ATCCTAGCTCTACCACTTCCTGG + Intergenic
908307837 1:62842039-62842061 ATCTGATCTATTCTACTTATAGG + Intronic
908528370 1:65009800-65009822 ATCCCAGCTCTGCCACTTACTGG - Intergenic
908816717 1:68042724-68042746 ATCCTGGCTCTGCTACTTACCGG + Intergenic
909155237 1:72066230-72066252 ATCCCAGCTCCACCACTTATCGG - Intronic
910213517 1:84818029-84818051 ATCCTGGCTCTTCCACTGATCGG + Intronic
911173842 1:94798650-94798672 ATCCTAGCTCTGCAACTTCCCGG + Intergenic
911479584 1:98421491-98421513 GTCCTAGCTTTTCTACTTAGTGG + Intergenic
912239924 1:107895541-107895563 ATCCTACCTCCTCTAACTATTGG - Intronic
912247252 1:107972490-107972512 ATGCTAGCTTTGCTACTTATTGG - Intergenic
912519630 1:110236320-110236342 ATCCCAGCTTTGCTACTTAATGG - Intronic
913158470 1:116123575-116123597 ATTCTGACTCTTCTACTTACTGG + Intronic
913278569 1:117163262-117163284 GTCCCAGCTCTGCCACTTATTGG + Intronic
914878813 1:151532205-151532227 ATCCTGGCTCTACCACTTACTGG - Intronic
915069478 1:153254341-153254363 ATCCTGGCTTTTCTACTTAAAGG + Intergenic
915787968 1:158636453-158636475 TTCAGAACTCTTCTACTTATAGG + Intronic
915842121 1:159222339-159222361 ATCCCAACTCTGCTACTTATTGG + Intergenic
915938814 1:160105437-160105459 ATCCTAGGTCTACCACTAATTGG - Intergenic
916185667 1:162130282-162130304 ATCCTAGTTCTGCCACTTACAGG - Intronic
917083127 1:171276969-171276991 ATCCAAGCTCTTCAATTTGTGGG - Intronic
917626312 1:176850070-176850092 ATCCTGGCTCTGCCACTTACTGG - Intergenic
918984448 1:191605696-191605718 ATCCTGGCTTTGCTACTTACTGG + Intergenic
919094224 1:193010466-193010488 ATCCTAGATCTACTACTTACTGG + Intergenic
919438550 1:197596010-197596032 ATCCCAGCTTTGCCACTTATTGG - Intronic
920968774 1:210724358-210724380 ATCCTAACTCTACTGCTTACTGG - Intronic
922329094 1:224557984-224558006 ATCCTAGCTCTTCCTCTTAGTGG - Intronic
922870360 1:228897706-228897728 ATCCTGGCTCTTCCTCTTAGTGG - Intergenic
922967121 1:229699605-229699627 ATCCTTGCTTTGCTACTTACTGG + Intergenic
923658202 1:235936736-235936758 ATCCCAGCTCTTCCACTTACTGG - Intergenic
923800047 1:237200129-237200151 ATCCTAGCTCCTCCACATATTGG - Intronic
923839281 1:237650581-237650603 ATTCTAGCACTTCTACTTATAGG - Intronic
924820776 1:247488162-247488184 TTCCAAGCTCTGCTACTTAAAGG + Intergenic
924820799 1:247488358-247488380 ATCATAGGTCTTCTACTTTCTGG + Intergenic
1063758754 10:9047158-9047180 AACCCAGCTCTTCTACTTCCAGG + Intergenic
1065542898 10:26787913-26787935 ATACTAACTCTTTTGCTTATTGG + Intronic
1066428012 10:35326534-35326556 ATCCTAGCTCTTAGACTAAAAGG - Intronic
1066752161 10:38669095-38669117 ATCTTGGCTCCCCTACTTATTGG + Intergenic
1067091497 10:43267819-43267841 AGCCTTGCTCTGCCACTTATAGG - Intergenic
1067197363 10:44133640-44133662 ATCATGGCTCTGCCACTTATTGG - Intergenic
1067529486 10:47060013-47060035 ATACTCGCTCCTCTACTTGTTGG - Intergenic
1069546168 10:69330437-69330459 ATCCTAGCTCTTCTGCTTTCTGG - Intronic
1069881466 10:71596350-71596372 ATCCTGGCTCTGCCACTTCTTGG - Intronic
1070012429 10:72489445-72489467 ATCCCAGCTCTACCATTTATTGG - Intronic
1070325864 10:75388578-75388600 ATCCCAGCTCTGCTACTTCTTGG + Intergenic
1070390534 10:75966751-75966773 ATCATGGCTCTGCTATTTATTGG + Intronic
1070409909 10:76129879-76129901 TTCCTAGCTCTTCTACTCTCTGG + Intronic
1070750796 10:78962923-78962945 ATCCCAGCTCTGCTACCTACTGG + Intergenic
1071255308 10:83866998-83867020 ATTCTAGCTCTACCACTTAATGG + Intergenic
1071873079 10:89816218-89816240 ATCCTAGATCTACTGCTTACTGG - Intergenic
1072595103 10:96864194-96864216 ATCCTCATTCTTCTACCTATTGG - Intronic
1072959427 10:99915861-99915883 ATCTCAGCTCTTCTACTTACTGG - Intronic
1073005943 10:100324733-100324755 ATACTAGCTCCTCTACTTCCTGG - Intronic
1073565972 10:104535998-104536020 ATCCTTGCTCTGTTACTTCTAGG + Intergenic
1074164510 10:110863240-110863262 ATCCTAGTTGTGCTACTAATTGG - Intergenic
1075837415 10:125466587-125466609 ATCCTGGCTCCTCAACTTCTTGG - Intergenic
1077674207 11:4182858-4182880 ATCCCAGCTCTGCTACTTCCTGG - Intergenic
1077974598 11:7234733-7234755 AACCTGGCTCTCCTAATTATTGG + Intergenic
1078404898 11:11061924-11061946 ATCCTAACTCCACTATTTATTGG + Intergenic
1079099220 11:17530400-17530422 ATCCTGGCTCTGCCACTTACTGG + Intronic
1079305532 11:19317993-19318015 ATCCTAGCTCTGCCACTTACTGG + Intergenic
1079381949 11:19945853-19945875 ATTCAAGCTCCTCTACTTACTGG - Intronic
1079697668 11:23503083-23503105 ATCCCAGCTTTGCCACTTATTGG + Intergenic
1080267983 11:30421647-30421669 ATCTTGGCTCTACTACTTACTGG - Intronic
1080308930 11:30867296-30867318 ATCCCAGTTCTGCCACTTATTGG + Intronic
1080684058 11:34501100-34501122 CTCCTAGCTCTGCCACTTACGGG - Intronic
1080866888 11:36203399-36203421 ATCCTGGCTCTACGATTTATTGG - Intronic
1081322525 11:41708543-41708565 ATTCCAGCTCTTCTCCTTTTTGG + Intergenic
1081655351 11:44853618-44853640 ATCCTGGCTCTACCAGTTATTGG - Intronic
1081954772 11:47081508-47081530 ATCTGAGCTCTGCCACTTATTGG - Intronic
1082889296 11:58121520-58121542 ATCCTGGCTCCTCTACATGTGGG - Intronic
1084033847 11:66496132-66496154 ATCCTGGCTCTGCCACTTAGTGG - Intronic
1085299996 11:75452266-75452288 ATCCTGGCTCTGCTACCTACTGG + Intronic
1085382101 11:76129162-76129184 ATCTTAGCTCTTCCACTTGATGG - Intronic
1085840854 11:80010174-80010196 ATCCTGGCTCTGCCACTTAGAGG + Intergenic
1086095423 11:83045604-83045626 ATCCTGACTCTACCACTTATTGG + Intronic
1086458374 11:86981660-86981682 ATCTCAGCTCTACCACTTATTGG + Intergenic
1086917714 11:92550004-92550026 ATCCTAACTCTTCCATTTACAGG - Intronic
1087363111 11:97185672-97185694 ATTCTAGCTCCTCTACCTCTAGG - Intergenic
1087658815 11:100961259-100961281 ATCCTAGCTCAGCCACTTACAGG + Intronic
1088148645 11:106716436-106716458 ATCCTGGCTCTACTACTTAACGG + Intronic
1088437587 11:109832303-109832325 ATCCTATCTCTCCTACTTACTGG - Intergenic
1088735699 11:112725966-112725988 ATCCCAGCTCTACTACTTTCTGG + Intergenic
1089283910 11:117393608-117393630 ATCCTAGCTCTTCTACTTATTGG - Intronic
1089488126 11:118862961-118862983 ATCCCAGTTCTGCTACTTATTGG + Intergenic
1089745126 11:120611251-120611273 ATCCTAGCTCTGCTGATTACTGG + Intronic
1090006888 11:123010727-123010749 ATCCCAGTTCTGCTATTTATTGG - Intergenic
1090478888 11:127050176-127050198 ATCCTGACTCTACTACTTACTGG - Intergenic
1090917938 11:131182813-131182835 ATCCCAGCTCTGCTACTTACTGG + Intergenic
1090936359 11:131346261-131346283 ATCCTGACTCTTCCATTTATTGG + Intergenic
1090976425 11:131684025-131684047 ATTCTAACTCTACTACTTACTGG + Intronic
1091168873 11:133503182-133503204 AACCTAACTCTGCTACTTAAAGG - Intronic
1091825001 12:3505685-3505707 ATTCCAGCTCTGCTACTTACTGG - Intronic
1091914208 12:4256505-4256527 ATCCTGGCTCTACCACTTATTGG - Intergenic
1092236281 12:6812062-6812084 ATCCTAGCTCCACCACTTACGGG + Intronic
1096088798 12:48884390-48884412 ATCCCAGCTCTTCCACTTACCGG - Intergenic
1096551244 12:52373347-52373369 ATCCCAGGTCTTCCACTTACTGG - Intergenic
1097330342 12:58326224-58326246 GTCCCAGCTCTGCTACTTGTTGG + Intergenic
1097341819 12:58447504-58447526 ATTCTGGCTCTACTACTCATTGG - Intergenic
1097405630 12:59185780-59185802 AACTTAGCTCATCTACTTAGAGG + Intergenic
1097840956 12:64320675-64320697 ATCCTGGCTCTGCCACTTAATGG + Intronic
1098397811 12:70041051-70041073 ATCCTGGCTTCACTACTTATTGG - Intergenic
1098448421 12:70591365-70591387 ATTCTAGCTCTACCACTTACTGG + Intronic
1099041883 12:77666244-77666266 ATAATATCTCTTCTAATTATTGG + Intergenic
1099948550 12:89273693-89273715 ATCCTAGCTCCACCACTTACTGG - Intergenic
1100686926 12:96996591-96996613 ATCCCAGCACTTCTGCTTACTGG - Intergenic
1100769968 12:97910817-97910839 ACCCTAGCTCCTTTCCTTATTGG - Intergenic
1101511849 12:105400355-105400377 ATCCCAGTTCTTTTACTTACTGG + Intergenic
1101863993 12:108506472-108506494 ATCCCAGCTCCACCACTTATAGG + Intergenic
1102721830 12:115023207-115023229 ATCCTTGCCCTTTTACTTACTGG - Intergenic
1103236121 12:119374146-119374168 ATCCCAGCTCTGCCACTTAATGG + Intronic
1103715373 12:122942135-122942157 ATCCTGGCTCTGCCACTTCTAGG - Intronic
1111698513 13:91656987-91657009 ATCCAGGCTCTACTTCTTATTGG + Intronic
1112185319 13:97122876-97122898 ATGCTACCTCATCTACTAATTGG - Intergenic
1112229599 13:97575162-97575184 ATCCCAGATCTTCTACTCACTGG + Intergenic
1112605599 13:100902655-100902677 ATCCCAGCAGTTCTACTTTTAGG - Intergenic
1113287980 13:108874578-108874600 ATGCTAGCTCTGCCACTCATGGG - Intronic
1114003093 14:18282612-18282634 ATCCCAGCTCTTCCACTTTCTGG - Intergenic
1115161127 14:30395690-30395712 GACCTAGCCTTTCTACTTATGGG - Intergenic
1115429207 14:33297173-33297195 ATCCTAGCTCTGCCATTTACTGG + Intronic
1115604779 14:34989967-34989989 ATCCTAGCTCTGTTACATACTGG - Intronic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1116804934 14:49484405-49484427 CTCCTAGCTCATTTTCTTATAGG - Intergenic
1117125396 14:52617739-52617761 ATCCCAGCTCTACTGTTTATTGG + Intronic
1118149300 14:63172684-63172706 ATCCCAGCTCTTCAACTAGTAGG + Intergenic
1118372108 14:65146085-65146107 ATCCTGCCTCTGCCACTTATTGG - Intergenic
1118704367 14:68466865-68466887 AATCTAGCTCTTCCACTGATTGG - Intronic
1118928610 14:70217819-70217841 ATCTAAGCTCTGCTACTTATTGG - Intergenic
1119277829 14:73375406-73375428 ATTCCAGCTCTGCTACTTAGAGG - Intronic
1119839457 14:77780920-77780942 ATTTTATCTCTTTTACTTATAGG + Intergenic
1121102435 14:91259176-91259198 ATCCTGGCTCCTCCACTTACTGG + Intergenic
1121258311 14:92548309-92548331 ATCCCAGTTCTGCCACTTATTGG + Intronic
1121371940 14:93366896-93366918 GTCCTAGCACTTATATTTATTGG - Intronic
1121584784 14:95055770-95055792 ATCCTGGCTCTGCTCCTTACAGG + Intergenic
1122139832 14:99656327-99656349 ATCCCAGCTCTGCTACCTGTGGG + Intronic
1122394564 14:101414394-101414416 TGTCTATCTCTTCTACTTATGGG - Intergenic
1123388206 15:19840895-19840917 ATCCCAGCTCTTCCACTTTCTGG - Intergenic
1125768795 15:42151798-42151820 ACCCTGGCTCTACTACTTACTGG + Intronic
1127891517 15:63255891-63255913 ATCCTGGCTCTTCTTTTTAAAGG - Intronic
1128353267 15:66906212-66906234 ATCCTTCCTCTGCTACTTACTGG + Intergenic
1128648723 15:69395354-69395376 ATCCTAGCTCTGCTTCTTATTGG + Intronic
1129667147 15:77585589-77585611 ATCCTCACTCTGCTACTTACTGG + Intergenic
1129748222 15:78039849-78039871 ATCCCAGTCCTGCTACTTATTGG - Intronic
1129949938 15:79576768-79576790 ATCCCAGCTCCTCTACTTACTGG + Intergenic
1130015784 15:80185400-80185422 AGCCTGGCTCCTCTACTTATTGG - Intronic
1130018606 15:80207896-80207918 ATTCTAGCTTTTCTCCTTAGTGG + Intergenic
1130368377 15:83261570-83261592 ATGCTTGCTCTTCCATTTATAGG + Intronic
1130745690 15:86651498-86651520 ATTCCAGCACTGCTACTTATTGG + Intronic
1130904358 15:88229320-88229342 ATCCTAGTTCTCCTGCTCATGGG - Intronic
1131027640 15:89158272-89158294 CTCTTAGCTCTTCTACTTACTGG - Intronic
1131234232 15:90682331-90682353 CACCTAGCTCCCCTACTTATGGG + Intergenic
1131990315 15:98086764-98086786 ATCCTGGCTTTGCTACTTACGGG - Intergenic
1133699094 16:8292433-8292455 ATTCTGGCTCTGCCACTTATTGG + Intergenic
1134617837 16:15665355-15665377 ATTCCAGCTCTGCTACTTATTGG - Intronic
1134811496 16:17170879-17170901 GTCCTAGTTCTACTACTTATTGG + Intronic
1134917541 16:18085486-18085508 ATCCCAACTCTTCCACTTAATGG + Intergenic
1135185828 16:20314993-20315015 ATCCCAGCTCTGCTACTGACTGG - Intronic
1135270663 16:21066951-21066973 ATCCCAGCTTTTCTACCTAGTGG - Intronic
1135796170 16:25444952-25444974 ATCCTGGCTCTGCCACTTACTGG - Intergenic
1136018761 16:27426192-27426214 ATCCCAGCTCTGCCACTTATAGG - Intronic
1136730560 16:32407947-32407969 ATCTTGGCTCCCCTACTTATTGG - Intergenic
1137873316 16:51971609-51971631 ATCCTGGCTCCACTACTTAGTGG - Intergenic
1137904588 16:52307669-52307691 ATCCCAGCTCTACCACTTACCGG - Intergenic
1137944373 16:52719578-52719600 GTCCTGGCTCTTTTGCTTATTGG + Intergenic
1138041790 16:53679309-53679331 ATCCTGGCTCATCTTCTTATAGG + Intronic
1138166304 16:54804843-54804865 ATCCCAGCTCTGCCACTTGTTGG + Intergenic
1138190234 16:55008757-55008779 ATCCCAACTCTGCCACTTATGGG - Intergenic
1138276529 16:55738838-55738860 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138282454 16:55782196-55782218 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138286494 16:55814447-55814469 AGCCTGGCTCTGCTACTTACTGG + Intronic
1140545885 16:75808542-75808564 ATCCTAGCTTTGCCAATTATTGG + Intergenic
1141462147 16:84183968-84183990 ATCCCAGCTCTTCTCTTTACCGG - Intronic
1141552852 16:84817727-84817749 ATCCTGGCTCTTCTATTCAGAGG + Intergenic
1202995842 16_KI270728v1_random:109368-109390 ATCTTGGCTCCCCTACTTATTGG + Intergenic
1203022529 16_KI270728v1_random:421710-421732 ATCTTGGCTCCCCTACTTATTGG + Intergenic
1142830314 17:2543996-2544018 AACCTAGCACCTCTACTTTTAGG + Intergenic
1142928103 17:3258910-3258932 TTCCTAGTTCTACTACTAATGGG - Intergenic
1144116476 17:12097755-12097777 ATCCCATCTCTGCTACTTGTTGG - Intronic
1144403261 17:14927245-14927267 ACCCTAGTTCTTCTACTTACTGG + Intergenic
1148354562 17:46967246-46967268 ATCCCAGCTCTGCCACTTATTGG + Intronic
1149089403 17:52760539-52760561 ATCTTGACTCTGCTACTTATTGG + Intergenic
1149606388 17:57927950-57927972 ATCCTTCCTCTGCTACTTGTGGG - Intronic
1152979339 18:260689-260711 ATCCCAGCTCTACCACTTACTGG - Intronic
1153095243 18:1393781-1393803 GTCCTGGTTCTTCTACTTACTGG - Intergenic
1154534037 18:15379252-15379274 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1154955148 18:21246166-21246188 AACCTAGCTCTAGTACTCATTGG + Intronic
1155287279 18:24302936-24302958 ATCCTTACTCTTCCACTTACCGG - Intronic
1155674372 18:28411651-28411673 ATGCTAAATCTGCTACTTATTGG - Intergenic
1156735814 18:40257953-40257975 ATCATAGCCTTTCAACTTATTGG + Intergenic
1157676494 18:49572478-49572500 GTCCCAGCTCTGCTACTTATAGG - Intronic
1158165958 18:54540282-54540304 GTCCTGGCTCTTATACTTACAGG - Intergenic
1158694578 18:59692404-59692426 ATCCCAGCTCTACTACTTGGTGG - Intronic
1158877814 18:61749899-61749921 ATCCTGGCTATTGCACTTATTGG - Intergenic
1159001111 18:62975942-62975964 ATCTTAGCTCTGCCACTTGTAGG + Intronic
1159491281 18:69138360-69138382 ATCTTATCTCTGCTACTTACTGG - Intergenic
1160334951 18:78030859-78030881 ATCCTAGCTCATCTGTTTCTTGG + Intergenic
1162922312 19:13910462-13910484 ATCCGAGCTCTGCCACTTACTGG + Intronic
1165744919 19:38224809-38224831 ATCCTAGCTCTGCCACTTGGTGG + Intronic
1165954250 19:39492104-39492126 ATCCAAGCTCTACCACTTCTCGG + Intronic
1166726716 19:45032878-45032900 ATCCTGGCTCTGCTGCTTACTGG + Intronic
1167529209 19:50004480-50004502 ATCCCAGCTCTACTACTTCCAGG + Intronic
1167564623 19:50248655-50248677 ATCCCAGCTCTGCCACTTAGGGG - Intronic
1167565765 19:50255679-50255701 ATCCCAGCTCTGCCACTTACTGG - Intronic
1168429404 19:56266051-56266073 ATCCTACCTCTTCCAATTATTGG + Intronic
926691566 2:15738116-15738138 ATCCCAGCTCTGCCACTTACTGG + Intronic
926961211 2:18360362-18360384 ATCCCAGCTCTGCTTCTTACTGG + Intronic
927493736 2:23538132-23538154 ATCCTAGTTCTGCTACTTATTGG - Intronic
927727707 2:25439680-25439702 ATCCTAGCTTTGCTACTTTCTGG + Intronic
928439535 2:31280452-31280474 ATCCTAGATCTGCCATTTATTGG - Intergenic
928621356 2:33091449-33091471 ACCTCAGCTCTTCTACTCATGGG - Intronic
929031833 2:37656646-37656668 ATCCTAGCTCCTCCACATTTTGG - Intronic
929973338 2:46605743-46605765 ATCCCAGCTCTACTACTTCCTGG + Intronic
930080600 2:47444658-47444680 ATCCCAGCTCTGCTACCTACTGG - Intronic
930084818 2:47488757-47488779 ATCCCAGCTCTGCCACTTACTGG - Intronic
930358050 2:50346094-50346116 CTCCTAGCTTTTCTAATTAAGGG + Intronic
930784036 2:55253074-55253096 ATCCTGGCTATGCTACTTACTGG + Intronic
930798042 2:55413467-55413489 GTTCTAGCTGTGCTACTTATTGG - Intronic
931973412 2:67615623-67615645 ATCCTAGCTCCTACACTTACTGG - Intergenic
932060035 2:68487397-68487419 ATCCTGGCCCTACTACTTATTGG + Intronic
933606659 2:84390526-84390548 AACCTAGCCATTCTACTTCTAGG + Intergenic
934315159 2:91911235-91911257 ATCTTGGCTCCCCTACTTATTGG + Intergenic
935366125 2:102292738-102292760 GTCCTAGCTCTACTACTTACTGG - Intergenic
935682116 2:105647212-105647234 ATCCCAGCTCTTCTGCTTCCTGG + Intergenic
936066128 2:109333726-109333748 ATCCCAGCTCTGCCACGTATTGG + Intronic
937147647 2:119661130-119661152 AACCTGGCTCTTCTGCTAATTGG - Intronic
938100881 2:128497535-128497557 ATCCTAGGCCTGCTTCTTATCGG + Intergenic
938532780 2:132206439-132206461 ATCCCAGCTCTTCCACTTTCTGG + Intronic
940228063 2:151421240-151421262 GTCCTTGCTCTTCTCCTTAGTGG - Intronic
941135446 2:161711778-161711800 ATCTTAGCTATGCTACTTACTGG + Intronic
941746550 2:169092932-169092954 AATCTAGCTCTTCCACTTACTGG - Intronic
945440492 2:209872943-209872965 AGCCAAGCTCTTCTACCAATGGG + Exonic
945571897 2:211478681-211478703 ATTCAAGCTCTTCTACTTCTTGG + Intronic
946649844 2:221880317-221880339 ATCCTGGCTCTGCTACTCACTGG + Intergenic
947154430 2:227147089-227147111 GTCCTAACTCTTCTAGTTATAGG + Intronic
948136255 2:235638642-235638664 CTCCTAGTTCTCCTACTAATTGG - Intronic
1168867843 20:1104502-1104524 ATCCTTGCTCTACCACTTGTTGG - Intergenic
1169096392 20:2902947-2902969 ATCCCATCTCTGCTACTTTTTGG + Intronic
1169303350 20:4465936-4465958 ATCCTAGATCTTCTGCTTCTTGG + Intergenic
1169727205 20:8748361-8748383 ACCCTAGTTCTTCAACTCATTGG - Intronic
1172040632 20:32042297-32042319 ATCCCAGCTCTGGCACTTATTGG + Intergenic
1172970174 20:38867429-38867451 ATCCTAGCTCTGTTGCCTATTGG + Intronic
1173011956 20:39191001-39191023 ATCCCAGCTCTGCCACTTACAGG - Intergenic
1173192941 20:40889978-40890000 ATCCCAGCTCTGCTAGTTAGTGG - Intergenic
1173458946 20:43226372-43226394 ATTCTAGCTCTTCTACATACTGG - Intergenic
1173894494 20:46540427-46540449 ATCCTGGCTCTGCGGCTTATTGG + Intergenic
1173953807 20:47015154-47015176 ACCCCAGCTCTTCTGCCTATAGG - Intronic
1173968035 20:47128678-47128700 ATCCCAGCTCTGCCACTTATTGG + Intronic
1174457030 20:50656267-50656289 ATCCTAGCTCTGCCACTTGCTGG + Intronic
1174570309 20:51496714-51496736 ATCCTGGTTCTGCCACTTATTGG - Intronic
1174622902 20:51890249-51890271 ATCTTAGCTGTTATTCTTATCGG + Intergenic
1177097201 21:16850940-16850962 ATCCTGGCTCCACTACTTCTAGG + Intergenic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1179107428 21:38415165-38415187 ATCCTGGCTCTTCAAATGATTGG + Intronic
1179237384 21:39559810-39559832 CTCCCAGCTCTTCTGCTTAATGG + Intronic
1180406053 22:12555244-12555266 ATGTTAGCTCTTCTATATATGGG + Intergenic
1180427608 22:15213407-15213429 ATCCCAGCTCTTCCACTTTCTGG - Intergenic
1180510862 22:16087794-16087816 ATCCCAGCTCTTCCACTTTCTGG - Intergenic
1180541917 22:16457119-16457141 ATCTTGGCTCCCCTACTTATTGG + Intergenic
1181531209 22:23518542-23518564 ATCCCAGTTCTTCTGCTAATTGG + Intergenic
1181899353 22:26139880-26139902 ATCCTAGCTCCTCTGTTTCTTGG - Intergenic
1182787808 22:32922269-32922291 ATCCTAGCTTTGCCACTTATTGG + Intronic
1183277322 22:36907288-36907310 TTCCTAACTCTTCTTTTTATAGG - Intergenic
1184176141 22:42790286-42790308 ATCCCAGCTCCTCTACTTGTTGG + Intergenic
1184349891 22:43936593-43936615 ATCCTGGCTCTGCTATGTATTGG + Intronic
949382765 3:3464410-3464432 ATTCCAGCTCTGCTACTTCTTGG + Intergenic
949829592 3:8199627-8199649 ATCCCAGTTCTACTACTTACTGG + Intergenic
950338645 3:12221581-12221603 ATTCTAGCTCTTCTGCTTCCAGG - Intergenic
951696200 3:25448119-25448141 ATCCTCACTCTCCTACTTACTGG - Intronic
952018075 3:28983589-28983611 GACCTAGCTATTCTACTTCTTGG + Intergenic
952553801 3:34508869-34508891 TTTCTAGCTCTGCTACTTCTTGG - Intergenic
952818410 3:37465458-37465480 ATCCCAGCTCTGCCACTTACTGG + Intronic
955245033 3:57217226-57217248 TTCCTAGCTCTTCCACTGAGAGG - Intronic
955280185 3:57587498-57587520 TTCCTTGCTCCTCTACTGATAGG + Intronic
955747200 3:62151991-62152013 ATCCTAACTATTCTACTTAAAGG - Intronic
955851732 3:63227272-63227294 ATCTTAGCTCTTAGACTTTTTGG - Intergenic
955880432 3:63538752-63538774 ATTCTTGCTCTTATGCTTATGGG - Intronic
956827203 3:73008586-73008608 AACTTAGCTTTTCTACTTCTTGG + Intronic
957128627 3:76195703-76195725 ATCCTTATTCTTCTCCTTATTGG - Intronic
957548290 3:81668880-81668902 GTCCTAGCTCTTAGGCTTATTGG + Intronic
957848307 3:85769794-85769816 ATACTATATTTTCTACTTATAGG - Intronic
958709447 3:97699518-97699540 ATCCTAGCTCCACAACTTATGGG - Intronic
959185787 3:103046250-103046272 ATCCTAGCTCTTTCTCTTGTTGG - Intergenic
959708502 3:109360976-109360998 ATCCTAGCTTTTTTATTTCTTGG - Intergenic
960034425 3:113088203-113088225 ATCCTGGCTCTGCCATTTATTGG - Intergenic
960571085 3:119185974-119185996 AGCCTAGCTCTGCCACTTACTGG + Intronic
960614184 3:119581868-119581890 ATCCCAGCCCTGCCACTTATTGG + Intronic
960987595 3:123290831-123290853 ACCCCAGCTCTGCCACTTATTGG + Intronic
961837983 3:129680470-129680492 ATCCTGACTCTGCTGCTTATTGG - Intronic
963706660 3:148697327-148697349 ATCCTTACTCTTCTATTTTTTGG + Intergenic
963895326 3:150679530-150679552 ATCCTTGCTTTTCTCCTTACAGG - Intronic
964558354 3:157965529-157965551 ATCCTGGCTCTGCTGCTTAAGGG + Intergenic
965690425 3:171350839-171350861 ATCTTGGCTCTACCACTTATTGG - Intronic
965835601 3:172848493-172848515 ATCCCAGCTCTGCTATTTACTGG + Intergenic
966113556 3:176432933-176432955 ATCATAGCTCTGCCACTTAGGGG - Intergenic
966440899 3:179942917-179942939 ATTCTGGCTCTGCTACTTATGGG + Intronic
966571668 3:181450964-181450986 ATCCCAACTCTGCCACTTATTGG + Intergenic
966598929 3:181755565-181755587 ATTCTAGTTCTTCCACTTGTTGG - Intergenic
966679234 3:182623285-182623307 AACCTAGCAATTCTACTTCTAGG + Intergenic
966784783 3:183613395-183613417 ATCCCAGTTCTGCTACTTACTGG - Intergenic
969698484 4:8749741-8749763 ATTCTCCCTCTTCTACTTCTAGG - Intergenic
970394369 4:15651251-15651273 TTACTAGTTCTGCTACTTATTGG - Intronic
970543478 4:17102860-17102882 GTTCTAGCTTTTCTACTTTTTGG - Intergenic
971067313 4:23048244-23048266 ATCCACTCTCTTCTACTTCTTGG + Intergenic
971140126 4:23915983-23916005 ATCCTGGCTCTGCCATTTATAGG + Intergenic
971152792 4:24051576-24051598 ATCCCAGCACTTCCACTTGTGGG - Intergenic
971836332 4:31767977-31767999 TTCCTTGCTCTTCAACTTGTGGG - Intergenic
971959464 4:33467196-33467218 ACCCTAGCTCTTCTCCTTATTGG + Intergenic
973019950 4:45190567-45190589 ATCCTAGTTCTTCTACTGCCTGG - Intergenic
973848971 4:54942428-54942450 ATCCAAGGTCTTCAACTTTTAGG + Intergenic
976001514 4:80378976-80378998 TTACTTGCTCTTCTACTTTTTGG + Intronic
976128613 4:81859737-81859759 ATCCCAGCTCTGCCACTTATTGG - Intronic
976315670 4:83656347-83656369 AACCTAGCACTGCTACTTATTGG - Intergenic
976783753 4:88792273-88792295 ATCCTAGCTCATTTATTTCTTGG - Intronic
977145569 4:93435731-93435753 ATCCTGGTTCTTCCAGTTATTGG - Intronic
977604503 4:98968815-98968837 ATCCTAGCTCTGCTGCTTACTGG - Intergenic
978742230 4:112149540-112149562 GACCTAGTTCTTCTACTTCTAGG - Intronic
978944640 4:114480976-114480998 ATCATAATTCTTCTATTTATTGG + Intergenic
980572225 4:134634810-134634832 TTTCTACCTCTTCTACTTTTAGG - Intergenic
981904861 4:149911107-149911129 AGCCCAACTCTTCCACTTATAGG + Intergenic
982943747 4:161591896-161591918 ATCCTAGCTCCGCTAATTAGAGG - Intronic
983315079 4:166121652-166121674 ATTGCAGCTCTTCTACTTACAGG - Intergenic
983514507 4:168642035-168642057 ATCCTGGCTGTGCTCCTTATGGG - Intronic
984193041 4:176627077-176627099 ATCCTAGATCTGCCTCTTATTGG + Intergenic
984281849 4:177679813-177679835 ATCTTAGCTCTGCTACTTTCTGG - Intergenic
986990810 5:13550969-13550991 ATCCCATCTCTTCTTCTTCTTGG - Intergenic
987101730 5:14597053-14597075 ATTCTGGCTCTTCTACTTACTGG + Intronic
988996071 5:36715961-36715983 ATACTAGCTCTTATTATTATGGG + Intergenic
989273385 5:39558137-39558159 ACCCTGGCTCTGCTATTTATTGG + Intergenic
990038080 5:51347122-51347144 ATCTTAGCTCTTCTCCTAATAGG - Intergenic
990627112 5:57626477-57626499 ATTCTAGCTCTTCTACTAACTGG + Intergenic
991401238 5:66253963-66253985 ATCCCAGCTCTGCCACTTAGGGG - Intergenic
991411021 5:66345909-66345931 ATCCCAGCTCTGCCACTTACAGG + Intergenic
994818620 5:104618672-104618694 ATCCTAGCTCTTCTGATTACTGG + Intergenic
997588210 5:135057002-135057024 ATCCCAGCTCATCTGCTTACTGG - Intronic
997639274 5:135437950-135437972 ATCCCAGCTCTACCACTTACTGG - Intergenic
997998413 5:138604934-138604956 ATCCTAGCTCTACCACTTGATGG - Intergenic
998166880 5:139849215-139849237 ATCCCAGCTCTGCCACTTCTTGG - Intronic
998183315 5:139960562-139960584 ATCCTAACTCTATTACTTACTGG + Intronic
998425295 5:142021580-142021602 ATCCCAGCTCTACCACTTTTGGG + Intergenic
998687723 5:144548848-144548870 ATATAAGCTCTACTACTTATTGG - Intergenic
998841013 5:146253814-146253836 ATCCTAGTTGTGCTGCTTATTGG + Intronic
998985101 5:147748143-147748165 ATCCTGGCTCTACTTCTTGTTGG + Intronic
999440418 5:151596299-151596321 ATCCTAGCTCTACCATTTAAAGG - Intergenic
999803353 5:155058389-155058411 ATCCTGGCTCTACCACTTACAGG + Intergenic
1000106954 5:158068862-158068884 ATCCCGGCTCTGCCACTTATTGG - Intergenic
1000112260 5:158120270-158120292 ACCCTGGCTCTACCACTTATTGG - Intergenic
1000428584 5:161122753-161122775 ATCCTAGCAATTCTATTTCTAGG + Intergenic
1001082864 5:168679830-168679852 ATCCTAGCTCTGCCACTTACTGG + Intronic
1001593499 5:172882530-172882552 ATCCTAGCTCTGCCACTCACTGG + Intronic
1001712190 5:173787826-173787848 ATTTTAGCTCTGCTACTTACTGG + Intergenic
1001838201 5:174850340-174850362 ACTCTAGCTATTCTACTTTTAGG - Intergenic
1004174086 6:13323862-13323884 ATCCTAGCTCTGCCACTTACAGG + Intronic
1004316314 6:14591212-14591234 ATCCTGCCTCTGCTACTTATTGG + Intergenic
1004612336 6:17255300-17255322 ATCCTAGCTCTGCCTCTTACTGG - Intergenic
1005203531 6:23374869-23374891 CTCGAAGCTCTTCTTCTTATAGG - Intergenic
1007515915 6:42411343-42411365 ATTCTAGCTCATCTGCTTACTGG - Intronic
1008389641 6:50935157-50935179 ATCCTAATTCTTCCACTTAATGG - Intergenic
1008455407 6:51705183-51705205 CTCCTGGTTCTTCTACTTCTCGG - Intronic
1009774092 6:68182368-68182390 ATCCTAGCTCTTCTGTTGCTGGG - Intergenic
1009868732 6:69430343-69430365 AACCTTGCTTTTCTACATATTGG + Intergenic
1010499827 6:76584011-76584033 GTCCTAACTCTGCTACTTATTGG - Intergenic
1011193012 6:84753029-84753051 ATACTAACTCTTCTGCATATGGG + Intronic
1011361762 6:86533624-86533646 ATCTTAGTTCTTCTACTGAGTGG + Intergenic
1012068501 6:94580397-94580419 ATCCCAGATCTTCTGCTTACTGG - Intergenic
1012298478 6:97554346-97554368 GTCCTAGCTCTTAGGCTTATTGG + Intergenic
1014190741 6:118494125-118494147 ACCCTGGCTCTTCTACTAATGGG - Intronic
1015228376 6:130884809-130884831 ATCATAGCTTTTCTACTTTGAGG + Intronic
1015498773 6:133908697-133908719 ATCCAAGATCTCCTATTTATAGG + Intergenic
1015509246 6:134021679-134021701 ATCCCAGCTCTTCTACTTACTGG - Intronic
1017058713 6:150460706-150460728 GTCCTGGCTCTGCTACTTATGGG - Intergenic
1018492835 6:164313356-164313378 AACCTAGCCATTCTACTTTTAGG + Intergenic
1020965717 7:14865425-14865447 ATTCTAGCTCCTCACCTTATTGG + Intronic
1021936826 7:25639310-25639332 ACCCTGGCTCTGCTGCTTATTGG + Intergenic
1022412950 7:30153538-30153560 ATCCTGGCTCTGCCACTTACTGG + Intronic
1022472104 7:30688408-30688430 ATCCTAGCTCTTCCACCCAGCGG - Intronic
1022552888 7:31258640-31258662 ATCCTAGCTCTTTCACTTAATGG + Intergenic
1022955686 7:35378074-35378096 ATCCCAGCTCAGCGACTTATTGG + Intergenic
1023782685 7:43672090-43672112 ATACTAGCTCTTCTTTGTATGGG - Intronic
1025749077 7:64275674-64275696 ATCCTGGTTCTGCCACTTATGGG + Intergenic
1025794912 7:64730387-64730409 ATCCCAGTTCTGCCACTTATGGG + Intergenic
1026979950 7:74520350-74520372 ATCCTGGCTCCTCTACTTAGTGG + Intronic
1028661988 7:93288493-93288515 AACCTAGCAATTCTACTTCTAGG - Intronic
1031159159 7:118145158-118145180 ATCCTGGCTCCTCTACTGATTGG - Intergenic
1033867849 7:145714121-145714143 ATCCCAGCAGTTCTACTTTTAGG - Intergenic
1037340610 8:17840588-17840610 ATCCTGGCTCTATTACTTACTGG - Intergenic
1037570858 8:20156640-20156662 CTCCTTGCTCTTCTTCTTTTAGG + Intronic
1038129190 8:24710256-24710278 ATCCTAGCCCTACTCCTTACAGG - Intergenic
1038494375 8:27991113-27991135 ATCCTAGCTCCTCTGCGTATTGG + Intronic
1038494826 8:27993960-27993982 ATACTAGCTCTGCCACTTACTGG - Intergenic
1038793098 8:30686050-30686072 ATCCTAGCTCTGCAACTTACCGG + Intronic
1039496105 8:37981593-37981615 AGCCTACTTCTTCTATTTATGGG + Intergenic
1042325460 8:67523081-67523103 ATCCCAGCTCTGCCACTTGTAGG + Intronic
1042370731 8:67987973-67987995 ATACCTGCTCTTCTACCTATGGG - Intronic
1042638889 8:70910377-70910399 ATCTCAGCTTTTCTACTAATTGG + Intergenic
1043959327 8:86397969-86397991 ATTCCAGTTCTGCTACTTATTGG - Intronic
1044300054 8:90573266-90573288 ATCCTGGCCCCTCTTCTTATGGG - Intergenic
1044717105 8:95110618-95110640 ATCCCAGCTTTGCTACTTACTGG - Intronic
1044852185 8:96439961-96439983 ATCCTATCAATTCTACTTGTGGG - Intergenic
1044906672 8:97011595-97011617 ATCCTGGCTCTGACACTTATTGG + Intronic
1045943520 8:107767789-107767811 ATCCCAGCTTTGCTACTTATAGG - Intergenic
1046063453 8:109167387-109167409 TTCATAGCTCTTGTATTTATAGG - Intergenic
1046466019 8:114604460-114604482 ATATTATCTCTTCTCCTTATGGG + Intergenic
1046481687 8:114827539-114827561 TTTCTAGCTCTTCCACTTCTTGG - Intergenic
1047281197 8:123447590-123447612 ATCCTGGCTCTACTACTTACTGG - Intronic
1047765144 8:127984393-127984415 ATCCTAGCTCTGCCACTTGCTGG - Intergenic
1048186644 8:132248037-132248059 ATCCTAGCTCTGCCACTTCCTGG - Intronic
1048335479 8:133499115-133499137 ATCCCAGCTCTGCCACTTACCGG + Exonic
1048396408 8:134018414-134018436 ATCCCAGCTCTTTTACTTAATGG + Intergenic
1048999323 8:139814628-139814650 GTTCTAGCCCTGCTACTTATTGG - Intronic
1050173943 9:2850874-2850896 GTCCTATCTCCTCTAGTTATCGG + Intergenic
1050481167 9:6088149-6088171 ATCCCATGTCTTCTACTTTTTGG + Intergenic
1051746142 9:20297129-20297151 ATCCTTGCTCTCCCACTTGTTGG - Intergenic
1052275923 9:26676516-26676538 AACATGACTCTTCTACTTATTGG - Intergenic
1053685922 9:40522438-40522460 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1053711335 9:40812471-40812493 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1053935872 9:43150711-43150733 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1054277813 9:63102531-63102553 ATCCCAGCTCTTCCACTTTCTGG - Intergenic
1054299003 9:63357891-63357913 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1054397023 9:64662399-64662421 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1054421246 9:64933288-64933310 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1054431665 9:65167591-65167613 ATCCCAGCTCTTCCACTTTCTGG + Intergenic
1054498713 9:65853916-65853938 ATCCCAGCTCTTCCACTTTCTGG - Intergenic
1057772537 9:97981720-97981742 ATCCTAGCTCTGCTTCTTGCTGG + Intergenic
1058418411 9:104811854-104811876 ATCCTGACTTTGCTACTTATTGG - Intronic
1058899103 9:109426077-109426099 ATGCTACCTCTTATACTTAGAGG + Intronic
1058951550 9:109908424-109908446 ATCCCAGCTCTGCCACTTACTGG + Intronic
1059159599 9:112021484-112021506 ATCCTAGCTCTGCTAGGTACTGG + Intergenic
1059356955 9:113707349-113707371 ATCCCAGCTCTACCACTTACGGG - Intergenic
1059621206 9:116007678-116007700 ATCCCAGCTCTTATATTTAGTGG + Intergenic
1059691660 9:116690702-116690724 ATCCTTGCTCTATTACTTATTGG + Intronic
1059739219 9:117133372-117133394 ATCCTAGCTCTGCCACTGACTGG - Intronic
1060391146 9:123277969-123277991 ATCCCACGTCTTCCACTTATTGG - Intergenic
1061168943 9:128940914-128940936 ATCCACACTCTGCTACTTATGGG + Intronic
1061224664 9:129273932-129273954 GTCACAGCTCTGCTACTTATTGG + Intergenic
1061384557 9:130281246-130281268 ATCCCAGCACTGCCACTTATTGG + Intergenic
1062186577 9:135221657-135221679 ATCCCAGCTCTTCCCCTTGTTGG + Intergenic
1186017723 X:5216966-5216988 AGCCTAGCTCTGTTTCTTATAGG - Intergenic
1187432644 X:19239153-19239175 ATCTCAACTCTTCTACTTCTTGG - Intergenic
1187853322 X:23612663-23612685 ATCTGAGCTCTACCACTTATTGG - Intergenic
1188184552 X:27097904-27097926 ATCCAAGCTCTGCTACCTACTGG - Intergenic
1188585753 X:31772701-31772723 ATCCTTGTTCTGCTACTTACTGG + Intronic
1189167286 X:38872722-38872744 ATCCCAGCACTGCCACTTATTGG - Intergenic
1189604690 X:42664155-42664177 ATTTTAGCTCTGCTACTTCTAGG + Intergenic
1189741970 X:44128089-44128111 CTCCTAGCTATTCTACTCCTAGG - Intergenic
1190172843 X:48125370-48125392 CTCCTGGTTCTTTTACTTATTGG + Intergenic
1190859903 X:54334801-54334823 AAACTAGCAATTCTACTTATAGG + Intronic
1191654564 X:63582024-63582046 ATCCTGGTTCTTCGACTTAGAGG + Intergenic
1192498869 X:71635517-71635539 TGCCTCCCTCTTCTACTTATAGG + Intergenic
1193722814 X:85006382-85006404 AACCTAGTTCTTCCACTTAGTGG - Intronic
1193845035 X:86458170-86458192 ATCCAATCTCTTTTACTTCTAGG + Intronic
1194790308 X:98139940-98139962 ATCCCAGCTCTACCACTAATTGG + Intergenic
1195239427 X:102936580-102936602 ATCTTGGCTCTTATATTTATGGG + Intergenic
1195298276 X:103501473-103501495 ATCTTGGCTCTTATATTTATGGG - Exonic
1195367482 X:104140033-104140055 ATGCCAGATCTTCTGCTTATTGG - Intronic
1196056549 X:111362457-111362479 ATCCTAGCTCCACAACTCATTGG + Intronic
1196106161 X:111897890-111897912 ATCCCAGCAATTCTACTCATAGG - Intronic
1196188181 X:112766680-112766702 ATCCTAGCTCAGCTACTTACAGG - Intergenic
1196282772 X:113842612-113842634 ATCCCAGCTCTGCCACTTACTGG + Intergenic
1196749460 X:119101836-119101858 ATCCTAGCTATACCACTTATTGG + Intronic
1196928838 X:120661063-120661085 ATCCTAGCTCTGCAACATATTGG - Intergenic
1198637486 X:138715257-138715279 ATCCTATCTCTGCCACTAATTGG + Intronic
1198674811 X:139120485-139120507 ATCCTAGCTCCTCTTCCTTTTGG - Intronic
1198977429 X:142352411-142352433 ATGGTAGCTCATCTCCTTATTGG + Intergenic
1199018871 X:142852014-142852036 ATACTTCCTCTTCTACTTACTGG + Intergenic
1199549072 X:149038727-149038749 ATTGTAGCTCTTCCACTTAGCGG + Intergenic
1199907415 X:152247502-152247524 ATACCAGCTCTGCCACTTATTGG + Intronic
1199993078 X:153000683-153000705 ATCCTATCTCTCCACCTTATGGG + Intergenic
1201182829 Y:11366045-11366067 ATCTTGGCTCCCCTACTTATTGG + Intergenic