ID: 1089284388

View in Genome Browser
Species Human (GRCh38)
Location 11:117396214-117396236
Sequence ACCAGGATGGTGTGGGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089284383_1089284388 -8 Left 1089284383 11:117396199-117396221 CCTGGGGGCTGGGGCACCAGGAT 0: 1
1: 0
2: 4
3: 74
4: 1080
Right 1089284388 11:117396214-117396236 ACCAGGATGGTGTGGGGCATTGG 0: 1
1: 0
2: 0
3: 26
4: 262
1089284369_1089284388 21 Left 1089284369 11:117396170-117396192 CCCTTGGAACAGTGAGCTGGGGG 0: 1
1: 0
2: 1
3: 37
4: 235
Right 1089284388 11:117396214-117396236 ACCAGGATGGTGTGGGGCATTGG 0: 1
1: 0
2: 0
3: 26
4: 262
1089284371_1089284388 20 Left 1089284371 11:117396171-117396193 CCTTGGAACAGTGAGCTGGGGGC 0: 1
1: 0
2: 2
3: 22
4: 194
Right 1089284388 11:117396214-117396236 ACCAGGATGGTGTGGGGCATTGG 0: 1
1: 0
2: 0
3: 26
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089284388 Original CRISPR ACCAGGATGGTGTGGGGCAT TGG Intronic
900175796 1:1290838-1290860 CCCAGGATGGCCGGGGGCATGGG + Intronic
900625247 1:3604973-3604995 AGCAGGGTGGGGTGGGGCAGTGG - Intronic
902364370 1:15961794-15961816 ACCAGGGAGGTGGGGGGAATGGG + Intronic
902488483 1:16763724-16763746 TCCAGGAACATGTGGGGCATGGG - Intronic
902633660 1:17720668-17720690 TTCAAGATGGTGAGGGGCATCGG - Intergenic
902675541 1:18006191-18006213 ACCAGGCTGGTGAGGGGCAGTGG - Intergenic
903679796 1:25089236-25089258 AGCAGGATGGGGAGGGGCTTTGG + Intergenic
904298843 1:29541328-29541350 ACCAGGAGAATGTGGGTCATTGG + Intergenic
906845397 1:49186057-49186079 ATTATGATGGTGTGGAGCATCGG - Intronic
907515521 1:54991048-54991070 CCCAGGTTGGGGAGGGGCATTGG + Intronic
908257429 1:62314507-62314529 ACCAGGATGTGGAGGGGAATCGG + Intronic
908328482 1:63046919-63046941 ATCAGGATGGTGTGGGGGGAAGG + Intergenic
908571482 1:65415952-65415974 ACCAGGCTGATGTGTGGAATGGG - Intergenic
910467497 1:87515815-87515837 TGCAGGATGGTGTGGGACAGGGG + Intergenic
912430938 1:109628025-109628047 GCCAGGAAGGTCTGGGGCCTGGG - Intronic
912470679 1:109904834-109904856 GCCAGGAGGATGTGGGGCAGGGG - Intergenic
912562496 1:110560755-110560777 ACCAAGATGGGGTTGGGAATGGG - Intergenic
914460942 1:147884531-147884553 ACTAACATGGTGTGGGGCAGGGG + Intergenic
915493725 1:156266489-156266511 GAAAGGTTGGTGTGGGGCATGGG - Intronic
915523658 1:156463412-156463434 ACCAGAATGGTGTTGGGGGTGGG - Intergenic
916818105 1:168372715-168372737 AGCAGGAGGGCGTGGGGCACAGG + Intergenic
918588453 1:186214435-186214457 TCCAGGTTAGTGTGGGTCATAGG - Intergenic
918781366 1:188704110-188704132 GGTAGGATGGTTTGGGGCATAGG - Intergenic
919640615 1:200041049-200041071 TCCAGTTTAGTGTGGGGCATCGG + Intronic
919938286 1:202269304-202269326 ACCAGGCTGGTGTGGGAGTTTGG + Intronic
920201037 1:204259779-204259801 CCCAGCATGGAGTGGGGCAGGGG + Intronic
921964271 1:221071267-221071289 ACCTCGTTGGTGTGGGGCAATGG + Intergenic
922454281 1:225762302-225762324 GTCAGGATGGTTTGGGGGATGGG + Intergenic
924647656 1:245894077-245894099 TCCAGGGTGGAGTGGGGAATTGG + Intronic
1063205315 10:3825812-3825834 ACCAGGGTGGTGTCAGGCAAAGG - Intergenic
1063696493 10:8340503-8340525 ACCAGGATGGGATGGGGCAGAGG - Intergenic
1065720509 10:28624503-28624525 GCCAGGATTGGGTGAGGCATGGG + Intergenic
1065894850 10:30154340-30154362 TCCAGGAGAGTGTGGGGCAATGG - Intergenic
1069815551 10:71191591-71191613 GCCAGGAGGGTGAGGGGCAGGGG + Intergenic
1070004963 10:72414961-72414983 ACAAGAATGGTGAGAGGCATGGG - Intronic
1070159211 10:73855535-73855557 GGCAGGGTGGTGTGGGGCATGGG - Intronic
1070442819 10:76463418-76463440 ACTAGGATCTTGTGGGGCACTGG + Intronic
1070556339 10:77530622-77530644 ACAAGGAATGTTTGGGGCATTGG - Intronic
1071333593 10:84584502-84584524 ACCAGGATGCTGTGAGGGATGGG - Intergenic
1072553443 10:96496314-96496336 ACCAGCATGCTGTAGGGCATAGG - Intronic
1073067086 10:100767993-100768015 GCCAGGATGGGGTGGGGGAGGGG - Intronic
1073186049 10:101615611-101615633 AGCAGGATGGTTTGGGCCAGGGG - Intronic
1074412563 10:113241180-113241202 ACCAGTATGGTGTGTGGCCTGGG - Intergenic
1074769587 10:116724705-116724727 CCCAGGACAGTGTGGGGCAGAGG + Intronic
1075187503 10:120276254-120276276 ATGAGGATGGAGTGGGGCAGAGG - Intergenic
1075817211 10:125273800-125273822 GCCAGGATGGAGTGGCGAATCGG + Intergenic
1076504816 10:130964665-130964687 ACCAAGATGGTGTGGTGCCCTGG - Intergenic
1077215354 11:1393203-1393225 TCCAGGAGGGTGTGTGGCACGGG + Intronic
1078311404 11:10246931-10246953 CCCAGCATGGTGCTGGGCATGGG + Intronic
1079389556 11:20009759-20009781 AAAAGGATGGTTTGGGGCGTTGG - Intronic
1081583135 11:44366009-44366031 TCCAGGATGGTGTGTGGTATTGG + Intergenic
1083702246 11:64487152-64487174 ACCAGGATGGTGTGGGAGGAGGG + Intergenic
1084419120 11:69051562-69051584 ACCTGGATGTTGCGGGGCAGAGG + Intronic
1084556991 11:69881298-69881320 ACCCAGATGGGGTGGGGCATCGG - Intergenic
1084606015 11:70172264-70172286 TCCAGGAGGGTGAGGGGTATGGG + Intronic
1084742993 11:71151100-71151122 ACCTGGATGGTGAGGGGCAGTGG - Intronic
1086064494 11:82732171-82732193 ACCAAGATGGTTTGGGGTATGGG - Exonic
1088106546 11:106212882-106212904 ACCAGGGTGATGTGTGCCATGGG - Intergenic
1088545688 11:110956475-110956497 AAGGGGATGGTGTGGGCCATGGG + Intergenic
1089284388 11:117396214-117396236 ACCAGGATGGTGTGGGGCATTGG + Intronic
1089762564 11:120739075-120739097 ACCAGGCTGGTGTGGACCAAGGG - Intronic
1091334402 11:134755530-134755552 GACAGGATGGAGTGGGGCACTGG + Intergenic
1093919831 12:24847311-24847333 ACCACTCTGGTGTGAGGCATTGG - Intronic
1097038300 12:56138514-56138536 GCCAGGAAGTTATGGGGCATGGG - Intronic
1097184563 12:57189672-57189694 GCCAGAATGGTGAGGGGCAGAGG + Intronic
1097397903 12:59098298-59098320 ATCAGTATGGTGTGGGGGAAGGG + Intergenic
1097519856 12:60653855-60653877 TCCAGGCTGGTGTGGTGCAGTGG + Intergenic
1098191828 12:67957351-67957373 ATGAGGATGTTGTGGGGCATAGG - Intergenic
1101098833 12:101371571-101371593 ACCAGGCTGGAGTGGTGCAGTGG + Intronic
1101749511 12:107571776-107571798 ACCAGGCTGGTCTGTGGCATAGG + Intronic
1101783289 12:107857893-107857915 TCCAGAATGGAGTGGTGCATTGG + Intergenic
1101874946 12:108591773-108591795 GCCAGGATGGTGGAGGGCAGGGG - Exonic
1103027274 12:117583697-117583719 AGGAGGATGGTGTGGGCAATGGG - Intronic
1104471075 12:129030006-129030028 ACCGAGATGGTGTGGGGCGGGGG - Intergenic
1105290906 13:19052877-19052899 ACCATGGGGGTGTGGGGGATGGG - Intergenic
1108148166 13:47501440-47501462 AGCAGAGTTGTGTGGGGCATAGG - Intergenic
1108585705 13:51867851-51867873 ACCTGGACGGTGTGGGCCATTGG + Intergenic
1108704635 13:52974137-52974159 ACCAGCACCGTGTGGGGCACAGG - Intergenic
1111514193 13:89306284-89306306 AGGAGGATGAGGTGGGGCATGGG + Intergenic
1113046687 13:106163669-106163691 AACAGGATGGCCTGGGGCACTGG + Intergenic
1117989852 14:61422610-61422632 TCCAGGGTGCTGTGGGGCAGAGG - Intronic
1120706485 14:87751317-87751339 GCCAGGATGCTGTGGGACAGAGG + Intergenic
1120986969 14:90343528-90343550 AACATGATGGTGTGGGGAGTGGG + Intergenic
1121454534 14:94029882-94029904 AGAGGGATGGGGTGGGGCATGGG + Intronic
1122256696 14:100483393-100483415 GACAGGGTGGTGTGGGCCATTGG - Intronic
1122610794 14:102981934-102981956 ACCATGAGGGTGTGTGGCCTCGG - Intronic
1122930046 14:104928943-104928965 ACCAGGATGCGGTGGGGCCAGGG - Intronic
1122970651 14:105150832-105150854 GCCAGGAGGGTGTGTGGCGTGGG - Intronic
1124593652 15:31076166-31076188 TGCAGGGTGGTGTGGGGCAAGGG + Intronic
1125620509 15:41057410-41057432 CCCAGGATGGAGTGGTGCAGTGG - Intronic
1127869792 15:63061796-63061818 AGGAGGATGGTGTGGGGGAAAGG + Intronic
1128152156 15:65369855-65369877 ACCAGGTTGGAGTGGGGGTTAGG - Intronic
1129967695 15:79751626-79751648 ACTAGGCTGGAGTGGGGCAGTGG - Intergenic
1131035731 15:89220922-89220944 ATCAGCATGGTGTGAGGGATAGG - Intronic
1131047760 15:89326898-89326920 ATCAGGAAGGTGGGGAGCATGGG - Exonic
1131057630 15:89385029-89385051 ACCATGGTGGTGTGAGGCAGAGG + Intergenic
1132396639 15:101479658-101479680 AGCAGAACGGTGTGGGGCACAGG + Intronic
1132652592 16:1028389-1028411 AGCAGGAGAGTGTGGGGCGTGGG - Intergenic
1132826545 16:1908159-1908181 ACCAGGATGGCGTGGGCCACGGG - Intergenic
1134196936 16:12166483-12166505 AGCAGGAAGGCGGGGGGCATAGG + Intronic
1136024344 16:27460420-27460442 TCCAGGATGGAGAGGGGCACAGG - Intronic
1137714994 16:50593124-50593146 AGGAGGATGGTGTGGGGCGATGG - Intronic
1137781572 16:51101871-51101893 CCCAGGCTGGAGTGGTGCATTGG - Intergenic
1140700146 16:77574252-77574274 ACCATGGTGGTGTGAGGCATTGG - Intergenic
1140790916 16:78390110-78390132 AGCAGGTTGGTGACGGGCATGGG + Intronic
1140882679 16:79213185-79213207 ACCAGGAAGGTGTGGAGGCTGGG + Intergenic
1141198716 16:81881133-81881155 AACAGGAAGGTGTGGAGCACTGG + Intronic
1142848950 17:2695160-2695182 CCCAGGGTGGTGTGGGGCGTCGG - Intronic
1145361166 17:22213677-22213699 ACCAGAATTGTGTGTGCCATAGG + Intergenic
1146212034 17:30950331-30950353 ACCCGCATGGTGTAGGGCAGAGG + Intronic
1146461534 17:33049859-33049881 TCCAAAATGGTGAGGGGCATGGG - Intronic
1151141504 17:71996860-71996882 ACCAGGCAGGAATGGGGCATAGG + Intergenic
1151264808 17:72946639-72946661 GCCAGGATGCTGTGGAGAATGGG - Intronic
1151575775 17:74951977-74951999 ATGAGGATGGGGTGGGGCACGGG + Exonic
1151983125 17:77526131-77526153 ACCAGGAGGGGGTGGGGGGTGGG + Intergenic
1151997285 17:77618047-77618069 TCCAGGATGATGGGGGCCATAGG - Intergenic
1152659496 17:81535743-81535765 ATGAGGATGGTGAGGGGGATGGG - Intronic
1152659505 17:81535767-81535789 ATGAGGATGGTGAGGGGGATGGG - Intronic
1152721073 17:81924086-81924108 CCCTGGATGGGGTGGGGCAGGGG - Intronic
1153456625 18:5290155-5290177 ACCGGGATGGTGGGGGGTCTTGG - Exonic
1154150438 18:11902318-11902340 ACCAGTATGGTGAAGGGCCTGGG + Intronic
1157563548 18:48664574-48664596 CCCAGGGTGGGGTGGGGCAGGGG + Intronic
1159781460 18:72665493-72665515 ACCAGGAAGATGTGGAGTATGGG - Intergenic
1159917559 18:74200193-74200215 CCCTGGGTGGTGTGGGGCACTGG + Intergenic
1161509777 19:4663868-4663890 ACCAGGATGGAGTCGGGGGTTGG - Intronic
1162203091 19:9035425-9035447 AACAGGATGATGTGGAGGATGGG - Intergenic
1163027135 19:14518765-14518787 TCCAGGAAGGGGTGGGGCCTGGG + Intronic
1163785125 19:19271020-19271042 ACCAGCATAGAGTGGGTCATAGG + Exonic
1163870673 19:19819057-19819079 AACAGGATGGGGTGGGTGATAGG - Intronic
1163874785 19:19858912-19858934 AACAGGATGGGGTGGGTGATTGG - Intergenic
1165126908 19:33604555-33604577 ACCAGGATGGTGGGGGCTATGGG + Intergenic
1165642542 19:37402678-37402700 ACCTGGATGGTGTGGAGGAAAGG - Intergenic
1165756679 19:38297329-38297351 ACCAGGGTGGTGGGGGGTAGGGG + Intronic
1166210695 19:41304942-41304964 AACAGGATGTTGTGGGGCTGGGG - Intronic
1166850689 19:45759176-45759198 CACAGGCTGGTGTGGTGCATGGG + Intronic
1168343034 19:55636605-55636627 ACCAGGATGGAGCTGGGCCTTGG + Intronic
1168378908 19:55903807-55903829 ACCAGGAGGGAGTGGCCCATGGG - Intronic
1202702715 1_KI270713v1_random:516-538 TCCAGGAACATGTGGGGCATGGG + Intergenic
925298211 2:2792335-2792357 CCCAGGAGGGTGACGGGCATGGG - Intergenic
925896121 2:8473599-8473621 ACCAGGAAGGTGTGTGGCAGTGG - Intergenic
926084129 2:10010365-10010387 ACCGGCATGGTGTGGGGCTGGGG - Intergenic
926298219 2:11583570-11583592 ACCAGGCTGGTCGGGTGCATTGG + Intronic
926670573 2:15573721-15573743 AGCAGGATGGTGTGAAGTATGGG - Intergenic
927286156 2:21359085-21359107 ACCTGGCTGGTATGGGGCAGGGG - Intergenic
927461641 2:23304430-23304452 GCCAGGAAGGTGTGTGGAATGGG - Intergenic
927929536 2:27035355-27035377 ATCAGGACAGTGTGGGGCACTGG - Intronic
928087120 2:28352841-28352863 AGCAGGATGGTGGGGGGTAGGGG + Intergenic
928395247 2:30938737-30938759 ACCAAGATGGGGTAGGGCAAGGG + Intronic
929675153 2:43919240-43919262 ACCAGGTTGTGGTGGGGGATGGG - Intronic
929712517 2:44279382-44279404 TCCAGGATGGTGTGGGCAAAGGG - Intronic
931719205 2:65055413-65055435 ACCAGGGTGGCGTGGGGAAGAGG - Intergenic
932303509 2:70685451-70685473 ACCAGGACTGTGAGGGGCAGTGG - Intronic
932625501 2:73293093-73293115 ACCAGGAGGGACTGGGACATTGG - Intronic
936618514 2:114072372-114072394 ACCTGGATGCTGTGGCACATAGG + Intergenic
937295438 2:120807193-120807215 ACCAGCATGGTCTGGGGGATGGG + Intronic
938084586 2:128390482-128390504 TCCAGGGTGGTGTCTGGCATGGG - Intergenic
938160993 2:128984281-128984303 ACCAGTATTGTGTGGGGAAAAGG - Intergenic
938308017 2:130267814-130267836 CCCAGGATGCTGTGGAGCAAGGG - Intergenic
939821240 2:146959280-146959302 ACCAAGATGGGGTGGGGGCTGGG + Intergenic
942932727 2:181515052-181515074 ACGTGGATGGTCTGGGGCCTAGG - Intronic
943985470 2:194612254-194612276 ACCAGCATGGCCTGGGGCCTGGG + Intergenic
944188871 2:196979936-196979958 TCCTGGATGGTGTGGAGCAGGGG - Intronic
945063139 2:205925794-205925816 TCCAGGATTGTGGAGGGCATGGG - Intergenic
945881416 2:215328538-215328560 ACCAGGACGGTGAAGGGCAGAGG - Intronic
946461990 2:219877004-219877026 ACCATGATACTGTGGGGCTTTGG + Intergenic
947060001 2:226153619-226153641 AACATGATGCTGTGGGGCCTGGG - Intergenic
948178501 2:235962111-235962133 GTGAGGATGGTGTGGGGCGTGGG + Intronic
948721659 2:239904672-239904694 ACCAGGCTGGGGTGGGGCCCTGG - Intronic
948916719 2:241038034-241038056 ACCAGGTGGGTGAAGGGCATGGG - Intronic
1168762673 20:360189-360211 TCCAGGGTGGTGTGGGGGTTGGG - Intergenic
1169673041 20:8125533-8125555 TCCAGGATGGTGTGGTGGTTTGG + Intergenic
1169849955 20:10037342-10037364 AGCAGTATGGTGTGGGGCTGGGG - Intronic
1170749242 20:19130652-19130674 ACCAGGATGGTGGTGAGCACTGG + Intergenic
1171301379 20:24063952-24063974 AACAGGAAGGGGAGGGGCATTGG - Intergenic
1172225160 20:33300541-33300563 ACCAGGATGGTCTGGCCCTTTGG - Intronic
1172605673 20:36212021-36212043 ACCATGAGGGTGTGTGGCACAGG + Intronic
1174202488 20:48816756-48816778 GCGAGGAGGGTGTGGGGCATGGG - Intronic
1174699593 20:52594605-52594627 AGCAGGATGGTGAGGGTAATGGG - Intergenic
1174926334 20:54763959-54763981 AACAGGGTGGTCTGAGGCATGGG - Intergenic
1176063324 20:63181663-63181685 AGCTGGGTGGGGTGGGGCATAGG + Intergenic
1179388868 21:40969350-40969372 TCCAGGAAGGGATGGGGCATTGG + Intergenic
1180593274 22:16958095-16958117 TCCAGGATGGGGTGGGGCCCAGG - Intergenic
1181562206 22:23712095-23712117 CCCAGGATGGAGTGGTGCAGTGG - Intergenic
1181909645 22:26228484-26228506 ACCAGCATGGTGCTGGGCAATGG + Intronic
1182712943 22:32333891-32333913 TGCAGCATGGTGTGTGGCATGGG - Intergenic
1184400195 22:44269291-44269313 TGCAGTATGGTGTGTGGCATGGG - Intronic
950054229 3:10012066-10012088 ACCAGGGTTGTAGGGGGCATAGG - Intergenic
950305412 3:11912502-11912524 ACCAGGGTTGTAGGGGGCATAGG - Intergenic
950405490 3:12801719-12801741 ATCAGCATGGCGTGGGGCAGTGG + Intronic
950670951 3:14525125-14525147 AGGAGGATGCTGTGGGGAATAGG + Intronic
953842526 3:46400703-46400725 ACCAGGATGATGTGGGAAACTGG + Intergenic
953902395 3:46850620-46850642 ACTGGGATGGAGTGGGGAATGGG - Intergenic
954445746 3:50545975-50545997 ACCTGGGTGGGGTGGGGGATGGG - Intergenic
959732469 3:109619610-109619632 ACCAGGATGGAGTGAGGAACTGG - Intergenic
960259597 3:115551597-115551619 AGCAGGATGGTGTGAGGAAATGG - Intergenic
962849956 3:139300982-139301004 ACCAGGTTGGGGAGGGGCAGGGG + Intronic
966364949 3:179175113-179175135 ACCATGAAGGTATGGGGCATAGG - Intronic
967138855 3:186536052-186536074 ACCAGGATGGTGAGGAGTCTGGG + Intergenic
968645745 4:1739811-1739833 ACAAGGATGGCGAGGGGGATGGG - Intronic
968645754 4:1739835-1739857 ACAAGGATGGCGAGGGGGATGGG - Intronic
968652062 4:1764040-1764062 GCCAGGATGGTTGGGGGCAGAGG + Intergenic
969296699 4:6274495-6274517 AGCAACATGGTGTGGGGCGTCGG - Intronic
970423768 4:15928337-15928359 GCCAGGATGGCTGGGGGCATGGG - Intergenic
971165675 4:24180847-24180869 CCCAAAATGCTGTGGGGCATTGG - Intergenic
971173912 4:24262391-24262413 ACCATGAAGGTGTGGGGCTGGGG + Intergenic
981663532 4:147195435-147195457 TCCAGGTGGGTGTGGGTCATGGG - Intergenic
981980333 4:150784423-150784445 GCCAGGATCATGTGGGGCAAGGG - Intronic
984941499 4:184936218-184936240 GCCAGGAACGTGTGGGGCAAGGG - Intergenic
985365226 4:189223952-189223974 AGCATGATGGTGTTGGACATCGG - Intergenic
986858101 5:11894966-11894988 ACCAGTATGGGGTGGGGCTGGGG + Intronic
990493809 5:56326925-56326947 ACCAGCATGGTGTGAGGCTGAGG + Intergenic
991021665 5:61985698-61985720 ACCAGGATGTTGTAGGGAAGAGG - Intergenic
992778779 5:80109951-80109973 TCCAGGAATGTGTGGGGTATGGG - Intergenic
992801532 5:80300276-80300298 CACAGGATGGTGTGGGGGAGGGG + Intergenic
993723696 5:91345811-91345833 ACCAGGGTGGAGTGGTGCAGTGG + Intergenic
995969975 5:117956514-117956536 ACCAGCTTGGGGTGGGGCCTGGG - Intergenic
996500597 5:124211801-124211823 ACCATGCTGGAGTGGTGCATTGG - Intergenic
999927625 5:156396461-156396483 ATCAGGAGGGTTTGGGGCTTAGG + Intronic
1000287176 5:159836862-159836884 CCCAGCATGGAGGGGGGCATTGG - Intergenic
1000343410 5:160294795-160294817 ACCAGCATGGAGGGGGACATCGG - Intronic
1002161100 5:177314541-177314563 AACAGGATGGGACGGGGCATGGG + Intergenic
1002334559 5:178468926-178468948 ACCAGGATGGTGGGTGCCACAGG - Intronic
1003068122 6:2920539-2920561 GCCAGGATGGTTTGGGGGAGCGG - Intergenic
1004258090 6:14083424-14083446 ACCAGGATGCTGTGTGACCTTGG + Intergenic
1005102497 6:22187482-22187504 ACCAGCAAGGGATGGGGCATGGG + Intergenic
1006803799 6:36776095-36776117 CCAAGCATGGCGTGGGGCATGGG - Intronic
1006996870 6:38269551-38269573 ACCAAACTGGTGTGGGTCATAGG + Intronic
1012003160 6:93680182-93680204 ACCAGGCTGGAGTGGTGCAGTGG + Intergenic
1013451317 6:110284197-110284219 ACCAGGAAGGAGTGGGGCAAGGG + Intronic
1013651793 6:112202420-112202442 ACATGAATTGTGTGGGGCATAGG + Intronic
1013790011 6:113825846-113825868 ACCAGGATGTTGTAGGGGATTGG - Intergenic
1015489023 6:133804548-133804570 AACAGAATGGTGTGGGGCCAAGG - Intergenic
1016372304 6:143388228-143388250 ACCAGGCTGGAGTGGTGCAATGG + Intergenic
1016388087 6:143548534-143548556 CCCAGGCTGGTGTGTGGAATTGG - Intronic
1019212178 6:170415488-170415510 AACAGGAGGGTCTGGGGCGTGGG - Intergenic
1019587611 7:1813781-1813803 ACCAGGAGGATTTGGGGCAGAGG - Intergenic
1019983877 7:4641551-4641573 ACCTGGATGGAGGGCGGCATCGG - Intergenic
1022763946 7:33389268-33389290 AACAGAATGGAGTGGGGCAGGGG - Intronic
1024462305 7:49670985-49671007 GCCAGGATGGTGTGTGGTAATGG - Intergenic
1025849312 7:65233028-65233050 AGCAGGGTGGGGTGGGACATGGG - Intergenic
1029702309 7:102255116-102255138 ACCAGGGTGGTGAGGAGCACAGG - Exonic
1031555965 7:123176765-123176787 ACCAGGAGGGTGTGGGATCTTGG - Intronic
1032534746 7:132653416-132653438 ACCAGGATGTTGAGAAGCATAGG - Intronic
1033388187 7:140899791-140899813 ACCAGGAGGGTGAGGATCATTGG - Intronic
1034557207 7:151857884-151857906 ACTAGGAAGGAATGGGGCATAGG + Intronic
1035406802 7:158604123-158604145 AGCAGGTGGGTGTGGGGCAGAGG - Intergenic
1035430561 7:158817172-158817194 ACGATGAGGGGGTGGGGCATCGG + Intronic
1035468724 7:159096404-159096426 ACCAGGATGATGTGCAGCACAGG - Intronic
1035600782 8:895749-895771 TCCAGGTCGGTGTGGGGCAGTGG + Intergenic
1038319629 8:26514675-26514697 ACCAGGTCGGTGTGGGGGTTGGG + Intronic
1038490105 8:27964780-27964802 ACCAGGCTGGTGGGGGGTTTGGG - Intronic
1039420269 8:37431999-37432021 TCCAGGCTGGTGGTGGGCATGGG - Intergenic
1040385253 8:46910982-46911004 GCCAGGCTGGGGTGGGGCAGTGG - Intergenic
1043025922 8:75068792-75068814 ACCACGATGATGTGGAGGATGGG - Intergenic
1043594112 8:81864134-81864156 ACCAGGATGTTCTGTGGCTTGGG - Intergenic
1044540635 8:93404925-93404947 ACAAGGCTGTAGTGGGGCATGGG - Intergenic
1048017534 8:130511122-130511144 TTCAGGATTGTGTAGGGCATTGG - Intergenic
1048372509 8:133791849-133791871 GGTATGATGGTGTGGGGCATGGG + Intergenic
1048720850 8:137322631-137322653 AGGAGGATGGTGTGGGTCAGGGG + Intergenic
1048993227 8:139773595-139773617 TGCAGGCTGGCGTGGGGCATGGG - Intronic
1049230327 8:141478456-141478478 TCCAGGGTGGGGTGGGGCATGGG + Intergenic
1049988520 9:972633-972655 TCCAGGACGGTGTGGGGAAGCGG + Intergenic
1050691680 9:8234386-8234408 ACCAGGGAGGTGTGGGTGATGGG + Intergenic
1051600466 9:18867567-18867589 AGTAGGATGGAGTGGGGCATAGG - Intronic
1052988025 9:34502153-34502175 ACCAGGGTGGGGAGGGGCAGTGG + Intronic
1055967981 9:81883845-81883867 ATCAGGATTGTGTTGGGCAGAGG - Intergenic
1056425181 9:86468391-86468413 ATAAGGGTGGGGTGGGGCATTGG + Intergenic
1059275661 9:113094786-113094808 ACAAGGATGGTGCAGGGCAATGG + Intergenic
1059763779 9:117363882-117363904 ACTAGGATTGTGTAGTGCATAGG + Intronic
1061243843 9:129391112-129391134 TCAAGGTGGGTGTGGGGCATGGG + Intergenic
1061259986 9:129474880-129474902 ACCTAGAGGGTGTGGGGCGTGGG + Intergenic
1061416817 9:130451569-130451591 AGAAGGATGCTGTGGGGCAGGGG - Intronic
1061623688 9:131827896-131827918 GCCAGCATGATGTGGGGCAGGGG + Intergenic
1061821187 9:133227954-133227976 TCCAGGATTGTGAGGGTCATGGG + Intergenic
1062109780 9:134775811-134775833 ACCAGGGAGGTGAGGGGCAGGGG - Intronic
1062255185 9:135617527-135617549 CCCAGGATGGGGTGGGGGAGCGG + Intergenic
1062540808 9:137040891-137040913 CCCAGGGAGGTGTGGGGCGTGGG + Exonic
1062636123 9:137492682-137492704 TCCAGGATGGGGTGGGGCCATGG + Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1190087396 X:47407884-47407906 ACCAGGAAAGTGTGGGGTGTTGG - Intronic
1191723142 X:64251476-64251498 ACCAGCAAGGTGTGGGTCAAAGG + Intergenic
1192183527 X:68930793-68930815 AGCAGGGTGGGGTGGGGCAGGGG + Intergenic
1199940476 X:152621396-152621418 TCCAGGCTGTTATGGGGCATGGG + Intergenic
1199982920 X:152930716-152930738 ACCAGGAAGGTGTGTGGCCAGGG + Intronic
1200037971 X:153345662-153345684 ACCAAGCTGCTATGGGGCATGGG + Intronic
1201146731 Y:11068857-11068879 ACCTGGATGGTGAGGGGCAGTGG - Intergenic
1201378596 Y:13347680-13347702 TCCAGGCTGCTGTGGGGCAGTGG - Intronic
1201522720 Y:14893800-14893822 TCCAGGATGGTGTGCGCCACGGG - Intergenic
1201944707 Y:19499220-19499242 ACCACTATGGTGTGGGCTATAGG - Intergenic