ID: 1089287838

View in Genome Browser
Species Human (GRCh38)
Location 11:117419225-117419247
Sequence CCCTCTTCACACAAAGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089287838_1089287841 -9 Left 1089287838 11:117419225-117419247 CCTCTTTCTTTGTGTGAAGAGGG No data
Right 1089287841 11:117419239-117419261 TGAAGAGGGAAGGTCTCCCCAGG No data
1089287838_1089287842 -8 Left 1089287838 11:117419225-117419247 CCTCTTTCTTTGTGTGAAGAGGG No data
Right 1089287842 11:117419240-117419262 GAAGAGGGAAGGTCTCCCCAGGG No data
1089287838_1089287843 -4 Left 1089287838 11:117419225-117419247 CCTCTTTCTTTGTGTGAAGAGGG No data
Right 1089287843 11:117419244-117419266 AGGGAAGGTCTCCCCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089287838 Original CRISPR CCCTCTTCACACAAAGAAAG AGG (reversed) Intergenic
No off target data available for this crispr