ID: 1089288071

View in Genome Browser
Species Human (GRCh38)
Location 11:117420311-117420333
Sequence TCCCCAGCTGAGCCCCGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089288071_1089288075 -4 Left 1089288071 11:117420311-117420333 CCCTGGCGGGGCTCAGCTGGGGA No data
Right 1089288075 11:117420330-117420352 GGGACACGCAGGGCCATGCCTGG No data
1089288071_1089288079 20 Left 1089288071 11:117420311-117420333 CCCTGGCGGGGCTCAGCTGGGGA No data
Right 1089288079 11:117420354-117420376 ATGGTGCCATCCACCTCCACTGG No data
1089288071_1089288076 1 Left 1089288071 11:117420311-117420333 CCCTGGCGGGGCTCAGCTGGGGA No data
Right 1089288076 11:117420335-117420357 ACGCAGGGCCATGCCTGGAATGG No data
1089288071_1089288082 27 Left 1089288071 11:117420311-117420333 CCCTGGCGGGGCTCAGCTGGGGA No data
Right 1089288082 11:117420361-117420383 CATCCACCTCCACTGGGCCCAGG No data
1089288071_1089288080 21 Left 1089288071 11:117420311-117420333 CCCTGGCGGGGCTCAGCTGGGGA No data
Right 1089288080 11:117420355-117420377 TGGTGCCATCCACCTCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089288071 Original CRISPR TCCCCAGCTGAGCCCCGCCA GGG (reversed) Intergenic