ID: 1089288072

View in Genome Browser
Species Human (GRCh38)
Location 11:117420312-117420334
Sequence GTCCCCAGCTGAGCCCCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089288072_1089288080 20 Left 1089288072 11:117420312-117420334 CCTGGCGGGGCTCAGCTGGGGAC No data
Right 1089288080 11:117420355-117420377 TGGTGCCATCCACCTCCACTGGG No data
1089288072_1089288075 -5 Left 1089288072 11:117420312-117420334 CCTGGCGGGGCTCAGCTGGGGAC No data
Right 1089288075 11:117420330-117420352 GGGACACGCAGGGCCATGCCTGG No data
1089288072_1089288084 30 Left 1089288072 11:117420312-117420334 CCTGGCGGGGCTCAGCTGGGGAC No data
Right 1089288084 11:117420365-117420387 CACCTCCACTGGGCCCAGGAAGG No data
1089288072_1089288082 26 Left 1089288072 11:117420312-117420334 CCTGGCGGGGCTCAGCTGGGGAC No data
Right 1089288082 11:117420361-117420383 CATCCACCTCCACTGGGCCCAGG No data
1089288072_1089288079 19 Left 1089288072 11:117420312-117420334 CCTGGCGGGGCTCAGCTGGGGAC No data
Right 1089288079 11:117420354-117420376 ATGGTGCCATCCACCTCCACTGG No data
1089288072_1089288076 0 Left 1089288072 11:117420312-117420334 CCTGGCGGGGCTCAGCTGGGGAC No data
Right 1089288076 11:117420335-117420357 ACGCAGGGCCATGCCTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089288072 Original CRISPR GTCCCCAGCTGAGCCCCGCC AGG (reversed) Intergenic