ID: 1089288075

View in Genome Browser
Species Human (GRCh38)
Location 11:117420330-117420352
Sequence GGGACACGCAGGGCCATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089288071_1089288075 -4 Left 1089288071 11:117420311-117420333 CCCTGGCGGGGCTCAGCTGGGGA No data
Right 1089288075 11:117420330-117420352 GGGACACGCAGGGCCATGCCTGG No data
1089288064_1089288075 12 Left 1089288064 11:117420295-117420317 CCACTTGTCACAAAGGCCCTGGC No data
Right 1089288075 11:117420330-117420352 GGGACACGCAGGGCCATGCCTGG No data
1089288072_1089288075 -5 Left 1089288072 11:117420312-117420334 CCTGGCGGGGCTCAGCTGGGGAC No data
Right 1089288075 11:117420330-117420352 GGGACACGCAGGGCCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089288075 Original CRISPR GGGACACGCAGGGCCATGCC TGG Intergenic