ID: 1089288079 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:117420354-117420376 |
Sequence | ATGGTGCCATCCACCTCCAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1089288072_1089288079 | 19 | Left | 1089288072 | 11:117420312-117420334 | CCTGGCGGGGCTCAGCTGGGGAC | No data | ||
Right | 1089288079 | 11:117420354-117420376 | ATGGTGCCATCCACCTCCACTGG | No data | ||||
1089288071_1089288079 | 20 | Left | 1089288071 | 11:117420311-117420333 | CCCTGGCGGGGCTCAGCTGGGGA | No data | ||
Right | 1089288079 | 11:117420354-117420376 | ATGGTGCCATCCACCTCCACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1089288079 | Original CRISPR | ATGGTGCCATCCACCTCCAC TGG | Intergenic | ||