ID: 1089288080

View in Genome Browser
Species Human (GRCh38)
Location 11:117420355-117420377
Sequence TGGTGCCATCCACCTCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089288072_1089288080 20 Left 1089288072 11:117420312-117420334 CCTGGCGGGGCTCAGCTGGGGAC No data
Right 1089288080 11:117420355-117420377 TGGTGCCATCCACCTCCACTGGG No data
1089288071_1089288080 21 Left 1089288071 11:117420311-117420333 CCCTGGCGGGGCTCAGCTGGGGA No data
Right 1089288080 11:117420355-117420377 TGGTGCCATCCACCTCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089288080 Original CRISPR TGGTGCCATCCACCTCCACT GGG Intergenic