ID: 1089288082

View in Genome Browser
Species Human (GRCh38)
Location 11:117420361-117420383
Sequence CATCCACCTCCACTGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089288078_1089288082 -10 Left 1089288078 11:117420348-117420370 CCTGGAATGGTGCCATCCACCTC No data
Right 1089288082 11:117420361-117420383 CATCCACCTCCACTGGGCCCAGG No data
1089288077_1089288082 -5 Left 1089288077 11:117420343-117420365 CCATGCCTGGAATGGTGCCATCC No data
Right 1089288082 11:117420361-117420383 CATCCACCTCCACTGGGCCCAGG No data
1089288072_1089288082 26 Left 1089288072 11:117420312-117420334 CCTGGCGGGGCTCAGCTGGGGAC No data
Right 1089288082 11:117420361-117420383 CATCCACCTCCACTGGGCCCAGG No data
1089288071_1089288082 27 Left 1089288071 11:117420311-117420333 CCCTGGCGGGGCTCAGCTGGGGA No data
Right 1089288082 11:117420361-117420383 CATCCACCTCCACTGGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089288082 Original CRISPR CATCCACCTCCACTGGGCCC AGG Intergenic