ID: 1089288084

View in Genome Browser
Species Human (GRCh38)
Location 11:117420365-117420387
Sequence CACCTCCACTGGGCCCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089288078_1089288084 -6 Left 1089288078 11:117420348-117420370 CCTGGAATGGTGCCATCCACCTC No data
Right 1089288084 11:117420365-117420387 CACCTCCACTGGGCCCAGGAAGG No data
1089288077_1089288084 -1 Left 1089288077 11:117420343-117420365 CCATGCCTGGAATGGTGCCATCC No data
Right 1089288084 11:117420365-117420387 CACCTCCACTGGGCCCAGGAAGG No data
1089288072_1089288084 30 Left 1089288072 11:117420312-117420334 CCTGGCGGGGCTCAGCTGGGGAC No data
Right 1089288084 11:117420365-117420387 CACCTCCACTGGGCCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089288084 Original CRISPR CACCTCCACTGGGCCCAGGA AGG Intergenic