ID: 1089288264

View in Genome Browser
Species Human (GRCh38)
Location 11:117421465-117421487
Sequence CTCTTTGGTGATTCGTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089288264_1089288270 -3 Left 1089288264 11:117421465-117421487 CCTTCCCACGAATCACCAAAGAG No data
Right 1089288270 11:117421485-117421507 GAGGAGGCCTGCCTTGCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089288264 Original CRISPR CTCTTTGGTGATTCGTGGGA AGG (reversed) Intergenic
No off target data available for this crispr