ID: 1089289059

View in Genome Browser
Species Human (GRCh38)
Location 11:117426863-117426885
Sequence CTGTGGATCAGGAACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089289059_1089289064 24 Left 1089289059 11:117426863-117426885 CCTTCCAGGTTCCTGATCCACAG No data
Right 1089289064 11:117426910-117426932 GAGCCCCCTGTGCACTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089289059 Original CRISPR CTGTGGATCAGGAACCTGGA AGG (reversed) Intergenic
No off target data available for this crispr