ID: 1089289064

View in Genome Browser
Species Human (GRCh38)
Location 11:117426910-117426932
Sequence GAGCCCCCTGTGCACTTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089289063_1089289064 -4 Left 1089289063 11:117426891-117426913 CCTCAATTGCAGTGCTCAAGAGC No data
Right 1089289064 11:117426910-117426932 GAGCCCCCTGTGCACTTCTTAGG No data
1089289060_1089289064 20 Left 1089289060 11:117426867-117426889 CCAGGTTCCTGATCCACAGCTCA No data
Right 1089289064 11:117426910-117426932 GAGCCCCCTGTGCACTTCTTAGG No data
1089289061_1089289064 13 Left 1089289061 11:117426874-117426896 CCTGATCCACAGCTCAGCCTCAA No data
Right 1089289064 11:117426910-117426932 GAGCCCCCTGTGCACTTCTTAGG No data
1089289062_1089289064 7 Left 1089289062 11:117426880-117426902 CCACAGCTCAGCCTCAATTGCAG No data
Right 1089289064 11:117426910-117426932 GAGCCCCCTGTGCACTTCTTAGG No data
1089289059_1089289064 24 Left 1089289059 11:117426863-117426885 CCTTCCAGGTTCCTGATCCACAG No data
Right 1089289064 11:117426910-117426932 GAGCCCCCTGTGCACTTCTTAGG No data
1089289058_1089289064 28 Left 1089289058 11:117426859-117426881 CCTTCCTTCCAGGTTCCTGATCC No data
Right 1089289064 11:117426910-117426932 GAGCCCCCTGTGCACTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089289064 Original CRISPR GAGCCCCCTGTGCACTTCTT AGG Intergenic
No off target data available for this crispr