ID: 1089296755

View in Genome Browser
Species Human (GRCh38)
Location 11:117473858-117473880
Sequence CACAAGCAAGTGCCCACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089296755_1089296760 -5 Left 1089296755 11:117473858-117473880 CCTGCTGTGGGCACTTGCTTGTG 0: 1
1: 0
2: 1
3: 21
4: 202
Right 1089296760 11:117473876-117473898 TTGTGGGTTTGGGACAGAACAGG 0: 1
1: 1
2: 3
3: 35
4: 187
1089296755_1089296763 14 Left 1089296755 11:117473858-117473880 CCTGCTGTGGGCACTTGCTTGTG 0: 1
1: 0
2: 1
3: 21
4: 202
Right 1089296763 11:117473895-117473917 CAGGCTAGTCATGTGGAGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 160
1089296755_1089296762 10 Left 1089296755 11:117473858-117473880 CCTGCTGTGGGCACTTGCTTGTG 0: 1
1: 0
2: 1
3: 21
4: 202
Right 1089296762 11:117473891-117473913 AGAACAGGCTAGTCATGTGGAGG 0: 1
1: 0
2: 1
3: 15
4: 131
1089296755_1089296761 7 Left 1089296755 11:117473858-117473880 CCTGCTGTGGGCACTTGCTTGTG 0: 1
1: 0
2: 1
3: 21
4: 202
Right 1089296761 11:117473888-117473910 GACAGAACAGGCTAGTCATGTGG 0: 1
1: 0
2: 0
3: 6
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089296755 Original CRISPR CACAAGCAAGTGCCCACAGC AGG (reversed) Intronic
900856608 1:5190429-5190451 CAAAAGCCAGAGCTCACAGCAGG + Intergenic
900866702 1:5274201-5274223 CCCCAGCTAGTGCCCAAAGCTGG + Intergenic
900908098 1:5575019-5575041 CACATGCAAGTGCCCCCAGCTGG - Intergenic
902700724 1:18170047-18170069 CACAAGCCCCAGCCCACAGCAGG + Intronic
902733267 1:18383747-18383769 CAGCAAGAAGTGCCCACAGCTGG + Intergenic
903892969 1:26582334-26582356 CACAAGCAAGTGGTCAAAGTTGG - Intergenic
904187059 1:28713761-28713783 CATAAGCCAGTGCACCCAGCTGG - Intronic
904370289 1:30043869-30043891 CACAGGCAAGTGCTCAGAGAGGG - Intergenic
905183173 1:36178815-36178837 CAGAAGCAGGTGCCCCCGGCGGG + Exonic
907317640 1:53582636-53582658 CACATGTAAGTGCTCACCGCAGG + Intronic
907902102 1:58750488-58750510 CACTGGCATGTGGCCACAGCTGG + Intergenic
908062040 1:60360790-60360812 CACAAGCAACTAGTCACAGCAGG - Intergenic
908344852 1:63221847-63221869 CAGAAAGAAGTGGCCACAGCAGG + Intergenic
909905432 1:81189223-81189245 CAAGAGAAAGTGCCCACAGCAGG + Intergenic
918014976 1:180624377-180624399 CCCAAGCAAGTGCCCAGAGAAGG - Intergenic
919219976 1:194616107-194616129 CACATGCCAGTGCCCACTGTAGG + Intergenic
921591455 1:217009216-217009238 CACAATGCAGGGCCCACAGCGGG + Intronic
922230543 1:223681911-223681933 AACAAGCCTGTTCCCACAGCAGG + Intergenic
922719846 1:227894794-227894816 CACAAGCATGTGCTCCCACCTGG - Intergenic
1063979810 10:11444346-11444368 TAGAGGCAAGTGCCCACAGCTGG - Intergenic
1066057318 10:31694355-31694377 CACAAGCAAACGCCCTGAGCAGG - Intergenic
1067295972 10:44975374-44975396 CACAAGGCACTGCCCAGAGCGGG - Intronic
1067364482 10:45612365-45612387 CCCAAGCAAGTCCCCAAACCTGG - Intergenic
1070418058 10:76208612-76208634 CAAAAGCCAGTGGGCACAGCTGG - Intronic
1071529260 10:86376825-86376847 CACAAGCAAAGGCCCAGAGCAGG + Intergenic
1071690848 10:87818183-87818205 CAAGAGCAAGTGCCCTCAGCCGG + Intronic
1075591082 10:123692232-123692254 CCCAAGCAAGTGCCCCCAAGGGG - Exonic
1075835363 10:125448358-125448380 CACAAACAAGTGGCCAGAGGTGG - Intergenic
1076809698 10:132880086-132880108 CACACACACGTGCGCACAGCAGG - Intronic
1079909527 11:26292437-26292459 CACCAGCAACTGAGCACAGCTGG - Intergenic
1080026005 11:27616006-27616028 CAGAGGCAAGTGTCCAGAGCTGG - Intergenic
1080869757 11:36227088-36227110 CACAAACACCTGCCCACTGCCGG - Exonic
1083332441 11:61905246-61905268 CACAAGCACGTGCACACAGGAGG + Intronic
1083639552 11:64138137-64138159 AGCTAGCAAGTGGCCACAGCAGG + Intronic
1083641238 11:64146500-64146522 CCCAAGCAAGTGGCCTCAGCTGG + Intronic
1084020891 11:66417312-66417334 CACATGCCTGTGCCCACACCAGG + Intergenic
1084246679 11:67862457-67862479 CACAACCAAGTACCAAAAGCTGG - Intergenic
1084743244 11:71152489-71152511 CAAAACCAACAGCCCACAGCAGG + Intronic
1084781980 11:71415978-71416000 GACAAGCAAAAGCCCAGAGCTGG + Intergenic
1084826000 11:71732034-71732056 CACAACCAAGTACCAAAAGCTGG + Intergenic
1086545654 11:87964672-87964694 TACCACCAAGTGGCCACAGCGGG - Intergenic
1088593049 11:111419670-111419692 CACCAGCAAGTACCAGCAGCGGG + Intronic
1088761448 11:112932754-112932776 CACACCCAAGTTCCCACAGCTGG + Intergenic
1089296755 11:117473858-117473880 CACAAGCAAGTGCCCACAGCAGG - Intronic
1089920392 11:122204127-122204149 CACAAGCAAGATCTCACAACTGG + Intergenic
1090647890 11:128780667-128780689 CACAACCAAACGCCCACAGCTGG + Intronic
1091927968 12:4370846-4370868 CACAAGCATGTGGCCCCAGGAGG - Intronic
1092120708 12:6041834-6041856 CAAAAGCATGGGTCCACAGCAGG + Intronic
1092417248 12:8299704-8299726 CACAACCAAGTACCAAAAGCTGG - Intergenic
1093525607 12:20101477-20101499 CAGATGCAGGTGCCCACAGTGGG - Intergenic
1096466883 12:51851561-51851583 CACATGCATGCGCCCGCAGCAGG - Intergenic
1097168118 12:57096497-57096519 CATGAGCAAGTGTCCAGAGCAGG + Exonic
1101976982 12:109368257-109368279 CCCAAGCAAGTGCCTAAAGCAGG + Intronic
1104395262 12:128427097-128427119 CACAAACAAGTGCCAGCAGACGG - Intronic
1104429627 12:128705828-128705850 CACAAGCAAGTGCCCCTGGAAGG + Exonic
1105293777 13:19071311-19071333 CACAAGCAAGGGCCCCTTGCGGG + Intergenic
1106589481 13:31087175-31087197 CACAACCAAGTTTACACAGCTGG - Intergenic
1107366318 13:39681463-39681485 CACAAGACAGAGCCCACAGTTGG - Intronic
1107795050 13:44043208-44043230 TACAGGCAACTCCCCACAGCTGG - Intergenic
1107990885 13:45818163-45818185 CTCAAGCAAGTTACCACTGCGGG - Intronic
1112567736 13:100565753-100565775 CACACAGAAGTCCCCACAGCTGG - Intronic
1113589224 13:111486538-111486560 CAGAAGCTACTGCCCACAGCTGG + Intergenic
1119618720 14:76115732-76115754 TACAAGCTAGTGATCACAGCTGG + Intergenic
1121925399 14:97922813-97922835 CACATGTATGTGCACACAGCAGG + Intergenic
1122753215 14:103955064-103955086 CACAGGCATGAGCCCACACCCGG + Intronic
1124064046 15:26323159-26323181 ATCCACCAAGTGCCCACAGCTGG + Intergenic
1124487289 15:30130155-30130177 CACAGCCAATTGCTCACAGCAGG - Intergenic
1124542379 15:30599130-30599152 CACAGCCAATTGCTCACAGCAGG - Intergenic
1124549084 15:30661248-30661270 CACAGCCAATTGCTCACAGCAGG - Intronic
1124756237 15:32408168-32408190 CACAGCCAATTGCTCACAGCAGG + Intergenic
1125732194 15:41899267-41899289 CCCAAGCTGGTGCCCACAGAGGG + Exonic
1128941231 15:71789371-71789393 CACGAGCAAGTTCCCTCACCTGG - Intergenic
1129158883 15:73736003-73736025 CACAAGCCTGTGCACACAGTAGG + Exonic
1130147152 15:81282902-81282924 CCCCAGCCAGTGCCCACAACAGG - Intronic
1130423894 15:83775940-83775962 CTCATGCACGTGCCCACATCTGG + Intronic
1131557295 15:93410990-93411012 CAGAACCAGGTGACCACAGCTGG - Intergenic
1134480117 16:14612011-14612033 TACAAACAAGAGCCCACTGCTGG - Intronic
1138692782 16:58784892-58784914 CACCAGCAAGTGAACAAAGCTGG - Intergenic
1138947082 16:61864526-61864548 CTCAAGCAAATTCCCCCAGCAGG + Intronic
1139587420 16:67913042-67913064 TACAGGCATGTGCCCACACCTGG - Intronic
1139914343 16:70418924-70418946 CCCGAGCAAGGGCACACAGCAGG + Intronic
1139965204 16:70741492-70741514 CACATGCGCGTGTCCACAGCTGG - Intronic
1140945849 16:79767780-79767802 CACAGGCAAGTGCCCTCTGCTGG - Intergenic
1142114529 16:88349416-88349438 CACACCCAAGTGCACACACCAGG + Intergenic
1143983415 17:10890564-10890586 CCGAAGCAGGTGCACACAGCAGG + Intergenic
1144506752 17:15838122-15838144 CACAATCAAGACCCCACAGAAGG - Intergenic
1145170933 17:20656057-20656079 CACAATCAAGACCCCACAGAAGG - Intergenic
1145774681 17:27519618-27519640 CACAAGCAAGCACCCAAGGCTGG - Intronic
1145976736 17:28988267-28988289 CACTAGGAAGTGCCCCCAGGAGG - Intronic
1147162687 17:38577266-38577288 CTCAAGCCAGTGCACACAGGAGG + Intronic
1147852637 17:43453711-43453733 CACACGCAGCTGCACACAGCTGG - Intergenic
1148747818 17:49928139-49928161 CACCAGCCCCTGCCCACAGCGGG - Intergenic
1149443039 17:56691142-56691164 CACAGGCCAGTGGCCACAGGAGG + Intergenic
1150580207 17:66466422-66466444 CACAAGCAAGTTCCCAGAAAGGG - Intronic
1150742203 17:67788360-67788382 CACAAGCAAGTGACTATAGATGG - Intergenic
1151178017 17:72305129-72305151 CACCAGGAGGTGCCCACACCAGG + Intergenic
1151773772 17:76183600-76183622 TACAAGCAAGTCATCACAGCTGG + Intronic
1153092493 18:1363903-1363925 CGGGAGCAAGTGCCCTCAGCTGG + Intergenic
1153660050 18:7318055-7318077 AGCCAGAAAGTGCCCACAGCGGG - Intergenic
1153744927 18:8167979-8168001 CACAAGCAAGGGCAGAAAGCTGG - Intronic
1154251855 18:12751300-12751322 CACCAGCAAGTGCACACAGAGGG + Intergenic
1157046363 18:44105637-44105659 CACAAGAAGGGGCCCACAACTGG + Intergenic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1162545338 19:11325689-11325711 CACAACCAAGGTCCCACAGCAGG - Intronic
1163212924 19:15854759-15854781 GCCAAGGAAGTGCCCACAGGTGG - Intergenic
1167049188 19:47068300-47068322 CAGAAAGAGGTGCCCACAGCTGG - Intronic
1168270242 19:55245833-55245855 CAGAAACAAGGGCCCACACCAGG + Intronic
927786733 2:25980090-25980112 CAGCAGGAAATGCCCACAGCAGG + Intronic
929665784 2:43832732-43832754 CACTAGGAAGTTCCCACAGAGGG + Intronic
930051318 2:47218295-47218317 AATAAGGAAGTACCCACAGCCGG + Intergenic
933455009 2:82508732-82508754 CAGACACAGGTGCCCACAGCAGG + Intergenic
933514872 2:83287977-83287999 CACAAGCAGGTGCACCAAGCAGG - Intergenic
936093699 2:109516420-109516442 CAGAAGCACGGGCCTACAGCTGG + Intergenic
937235600 2:120430225-120430247 CACAACCCAGTACACACAGCAGG + Intergenic
937236371 2:120433865-120433887 CACAATCAACTGCCCCCAGTGGG + Intergenic
937279509 2:120707721-120707743 CAAAAGCAAGTGCCCCTGGCAGG - Intergenic
938997307 2:136694048-136694070 CAAAAGCCAGTGCCCACAGTTGG + Intergenic
942812329 2:180013799-180013821 GACAAACAAGAGCCCACTGCAGG - Intergenic
943351283 2:186799288-186799310 CAGAAGGAAGTAACCACAGCAGG + Intergenic
946125185 2:217556531-217556553 GAAAATAAAGTGCCCACAGCAGG + Intronic
946730804 2:222707484-222707506 CACCAGTAAGTGCCCTGAGCAGG - Intronic
948718601 2:239882116-239882138 CAAGTGCAGGTGCCCACAGCTGG - Intergenic
949026983 2:241770882-241770904 CAGGAACAAGTGCCCACGGCTGG - Intergenic
1172975209 20:38900923-38900945 CACACGCAGGTGGCCGCAGCTGG + Intronic
1173907594 20:46640220-46640242 TACAAGAAAGTGCCGACACCTGG - Intronic
1174537744 20:51265589-51265611 CAAAAGCCAGTCACCACAGCAGG - Intergenic
1175200174 20:57271411-57271433 CAGAAGCAAGTGCTCCCAACAGG - Intergenic
1175266749 20:57708150-57708172 CATAAGCAAGTGTCCGCAGGCGG - Intronic
1175269251 20:57722302-57722324 CACCTGCAAGAGCCAACAGCTGG - Intergenic
1175987037 20:62769396-62769418 CACACACAAGTGCTCACACCCGG + Intergenic
1176385106 21:6135194-6135216 CCCAAGGAAGCACCCACAGCAGG + Intergenic
1179738367 21:43403058-43403080 CCCAAGGAAGCACCCACAGCAGG - Intergenic
1180259477 21:46658916-46658938 CTGAAGTAAGTGTCCACAGCTGG + Exonic
1181832080 22:25568223-25568245 CACAAGCAAAGGCCCACAAAGGG + Intronic
1181867729 22:25872622-25872644 TACAAGCAAGTGGCAACACCAGG - Intronic
1182427727 22:30283740-30283762 CCCAAGCCAGGGCCCACACCAGG + Intergenic
1182465323 22:30512245-30512267 CCCAAGCAAGTTCCCGCTGCTGG - Intergenic
1182878568 22:33713493-33713515 CACAAGCCAGCACACACAGCTGG + Intronic
1184420351 22:44378522-44378544 CAAAAGCAAGTGCCCTAAGAAGG - Intergenic
1184573454 22:45342379-45342401 CACAAGCAAGTGCACTATGCTGG - Intergenic
1184859021 22:47162850-47162872 CACGAGGAAGTGCCTACACCGGG - Intronic
949797055 3:7862852-7862874 AACAAGCAAGTGACCAGGGCAGG + Intergenic
949955183 3:9261314-9261336 CACAAGCAAGGGAACAAAGCTGG + Intronic
950539197 3:13599854-13599876 CACATGCACATGCCCACAGCTGG - Intronic
950616874 3:14166850-14166872 CAAAAGCCAGTGCCTGCAGCTGG + Intronic
951256368 3:20454020-20454042 CACAATCAAGGGGCCACAACTGG - Intergenic
952411653 3:33054906-33054928 CACAACCCAGTTCCCACAGCAGG + Intronic
953311218 3:41881451-41881473 CACAGCCAATTGCTCACAGCAGG + Intronic
954443993 3:50536811-50536833 CACAGGCAGGTGCCCACTGAAGG - Intergenic
954608857 3:51933731-51933753 CACCAGGAAGTCCCCAGAGCTGG + Exonic
957898876 3:86462179-86462201 CACAGTCAAGGGGCCACAGCGGG + Intergenic
959443768 3:106412281-106412303 CTCATGCTAGTTCCCACAGCTGG + Intergenic
959534383 3:107469006-107469028 CTCAGGCAACTGCTCACAGCTGG + Intergenic
960067432 3:113388273-113388295 AATAAGCAAGTTCCCACAACTGG - Intronic
960864423 3:122184799-122184821 CACAAGAAACTACCAACAGCAGG - Intronic
961813051 3:129532764-129532786 AACAAGCAGGTGCCTACTGCGGG + Exonic
961826721 3:129603119-129603141 CACTGGCCTGTGCCCACAGCGGG + Intronic
962726815 3:138236560-138236582 CACTAGCATGTGCCCACAGGAGG - Intronic
963329228 3:143895452-143895474 CACAAGAAAATTTCCACAGCAGG - Intergenic
969747977 4:9088900-9088922 CACAACCAAGTACCAAAAGCAGG + Intergenic
970598283 4:17619584-17619606 CACCAGCAAGAGGCCACAGTGGG + Intronic
970646392 4:18126015-18126037 AACAGGTAAGAGCCCACAGCTGG - Intergenic
978988071 4:115040903-115040925 AACAAGTAATTGCCCACAGTTGG + Intronic
980645220 4:135635293-135635315 CTCTAGCAAGTGCACAGAGCTGG - Intergenic
981232660 4:142375851-142375873 TAACAGCAAGTGCCCACACCTGG + Intronic
981967025 4:150616249-150616271 TTCAAGCAAGTGACCAAAGCTGG + Intronic
985851114 5:2389655-2389677 CCCAGGCACATGCCCACAGCAGG + Intergenic
986253767 5:6084525-6084547 CACAAGCCTTTGCCCAAAGCTGG + Intergenic
986299730 5:6468360-6468382 CTCAGGCCAGTGCACACAGCAGG - Intronic
988682940 5:33501903-33501925 CAGAAGGAAGTAACCACAGCAGG + Intergenic
988790839 5:34606139-34606161 CAGAGGCAAATGCCCAAAGCAGG - Intergenic
992906981 5:81356536-81356558 CAAAAGGAAGAGACCACAGCTGG - Intronic
995056524 5:107765535-107765557 CACAAGGCAATGCCCAGAGCAGG - Intergenic
998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG + Intronic
1001077185 5:168638768-168638790 CACATCCAAGATCCCACAGCTGG - Intergenic
1002422320 5:179155032-179155054 CACAGGCAACTGCCCCCGGCTGG + Intronic
1002530275 5:179840455-179840477 CACATACAAGAGTCCACAGCAGG + Intronic
1013472068 6:110474787-110474809 CTCCAGTAACTGCCCACAGCAGG - Intronic
1013730295 6:113156679-113156701 CACAACCAAGAGGCCACATCTGG - Intergenic
1016403116 6:143701662-143701684 AACTAGCAAGATCCCACAGCTGG - Intronic
1017162027 6:151374210-151374232 CACCAGCAGGAGCACACAGCAGG - Intronic
1018073864 6:160191809-160191831 CACATGCCTGTGCCCCCAGCCGG + Intronic
1018901200 6:168052618-168052640 CACAAACCAGTGCACGCAGCAGG - Intergenic
1020325026 7:6967733-6967755 CACAACCAAGTACCAAAAGCTGG - Intergenic
1021347554 7:19547274-19547296 CACCAGCAAGGGACCAAAGCTGG - Intergenic
1023770952 7:43556260-43556282 CACAAGCAAGGGCTGAGAGCGGG + Intronic
1023841426 7:44100680-44100702 CCCAACCGAGTCCCCACAGCTGG + Intergenic
1026788753 7:73318569-73318591 CCCAAGCAGCTGCCCACAGCTGG - Intronic
1027790753 7:82637134-82637156 CCCAAGCAAGTTGCCACTGCTGG - Intergenic
1028388751 7:90290853-90290875 CACAGGAAAGTGACCACAGCAGG + Intronic
1028663704 7:93315588-93315610 GACTAGCAAGTACCCAAAGCTGG - Intronic
1034590481 7:152133990-152134012 CACACGCTGGTGCCCACAGGCGG + Intergenic
1034959871 7:155358467-155358489 CTCCAGCAGGTCCCCACAGCAGG - Exonic
1035294883 7:157861379-157861401 CAGAAGCCACTGCCCACCGCAGG - Intronic
1035528853 8:335724-335746 CAAAAGGACGTGGCCACAGCAGG + Intergenic
1036751714 8:11447654-11447676 CACAGGCAGGTGCCAGCAGCTGG + Intronic
1037510129 8:19574192-19574214 CACAAGCCACTGCACCCAGCTGG + Intronic
1038251384 8:25908178-25908200 CACACACAGCTGCCCACAGCAGG - Intronic
1039863894 8:41484202-41484224 CACATGGAAGAGCCCACAGGGGG + Intergenic
1043263511 8:78231974-78231996 CAAGAGAAAGTGCCCACAACTGG + Intergenic
1043453658 8:80393000-80393022 CTCCAGCAAGTGCCCAGAGTAGG + Intergenic
1046560086 8:115825263-115825285 GCCAAGCAAATACCCACAGCAGG - Intergenic
1047735254 8:127759563-127759585 AACTAGCAAGTACACACAGCAGG + Intergenic
1048639509 8:136337747-136337769 CAGGAGCAAGAGTCCACAGCTGG - Intergenic
1048910751 8:139132509-139132531 CACAGGTAAGTGCCTGCAGCAGG - Intergenic
1049095609 8:140546469-140546491 CACAGGCCTGTGCACACAGCAGG + Intronic
1049359494 8:142205577-142205599 CACAGGCAAGCGCCCTCAGTGGG + Intergenic
1049394837 8:142395159-142395181 CACAGGAAAATGCCCACAGTGGG - Intronic
1049538900 8:143197206-143197228 CACAGCCAAATGCCCCCAGCAGG + Intergenic
1049836487 8:144738799-144738821 CACAAACAGGTGCCCCCAGGAGG - Intronic
1051239132 9:15033394-15033416 CAAAAGCAAGTGTCCCAAGCGGG - Intergenic
1056711578 9:88996095-88996117 CAAAAGTAAGTGTCCAGAGCTGG - Exonic
1059428641 9:114236824-114236846 TCCAAGCCAGAGCCCACAGCAGG + Intronic
1059665876 9:116446173-116446195 CACAAGCAAATCCATACAGCAGG + Intronic
1061873305 9:133531940-133531962 CACAGCAAAGTGGCCACAGCAGG - Intergenic
1062151717 9:135022718-135022740 CACAGGCAAGTGAGCTCAGCTGG - Intergenic
1062382932 9:136296308-136296330 CACCAGCAAGAGCCCCCAGGTGG - Intronic
1186865522 X:13717273-13717295 CACAGGCGACTGCTCACAGCTGG - Intronic
1191815500 X:65240591-65240613 CTCAAGCAAGGGCTCACAGCTGG - Intergenic
1192534150 X:71913105-71913127 CAAAAGCAAGAGGCCACACCAGG - Intergenic
1196817241 X:119675166-119675188 CCCAACCCACTGCCCACAGCTGG + Intronic
1197433715 X:126399280-126399302 CCCACGCAAATGCCTACAGCTGG + Intergenic
1197981853 X:132225556-132225578 CACAACTAAGTTCACACAGCCGG + Intergenic
1200078886 X:153565916-153565938 CTCCAGGCAGTGCCCACAGCAGG - Intronic
1201146964 Y:11070244-11070266 CAAAACCAACAGCCCACAGCAGG + Intergenic